View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9348-LTR4-TNT-insertion-1 (Length: 161)
Name: F9348-LTR4-TNT-insertion-1
Description: F9348-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9348-LTR4-TNT-insertion-1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 12 - 138
Target Start/End: Original strand, 1718099 - 1718225
Alignment:
| Q |
12 |
aagctgctaaaagtacaactgctcttatgataaaaggtggtgtcaaacctattgttgctggttatcactcggtgattgatgaaccatacaaaggagaagg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1718099 |
aagctgctaaaagtacaactgctcttatgataaaaggtggtgtcaaacctattgttgctggttatcactcggtgattggtgaaccatacaaaggagaagg |
1718198 |
T |
 |
| Q |
112 |
acaaatcgataagattgcacaattggt |
138 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
1718199 |
acaaatcgataagattgcacaattggt |
1718225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 83; Significance: 1e-39; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 1e-39
Query Start/End: Original strand, 12 - 130
Target Start/End: Complemental strand, 14508683 - 14508565
Alignment:
| Q |
12 |
aagctgctaaaagtacaactgctcttatgataaaaggtggtgtcaaacctattgttgctggttatcactcggtgattgatgaaccatacaaaggagaagg |
111 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14508683 |
aagctgctaaaagtacaatcgctctaatgataaaaggtggtgtcaaacctattgttgctagttttcactcggtgattgatgaactatacaaaggagaagg |
14508584 |
T |
 |
| Q |
112 |
acaaatcgataagattgca |
130 |
Q |
| |
|
|| | | |||||||||||| |
|
|
| T |
14508583 |
acgagttgataagattgca |
14508565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 38 - 103
Target Start/End: Original strand, 28231738 - 28231803
Alignment:
| Q |
38 |
atgataaaaggtggtgtcaaacctattgttgctggttatcactcggtgattgatgaaccatacaaa |
103 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||| ||||| || ||||||| || ||||||| |
|
|
| T |
28231738 |
atgataaaaggtggtgtcaaacctaacgttgctagttaccactcagttattgatggactatacaaa |
28231803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 38 - 91
Target Start/End: Original strand, 28326563 - 28326616
Alignment:
| Q |
38 |
atgataaaaggtggtgtcaaacctattgttgctggttatcactcggtgattgat |
91 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||||| ||||||||||||| |||||| |
|
|
| T |
28326563 |
atgataaaaggtggtctcagacctaatgttgctagttatcactcggttattgat |
28326616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 38 - 77
Target Start/End: Original strand, 28239431 - 28239470
Alignment:
| Q |
38 |
atgataaaaggtggtgtcaaacctattgttgctggttatc |
77 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
28239431 |
atgataaaaggtggtgtcaaacctaatgttgcttgttatc |
28239470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 17 - 91
Target Start/End: Complemental strand, 14470477 - 14470403
Alignment:
| Q |
17 |
gctaaaagtacaactgctcttatgataaaaggtggtgtcaaacctattgttgctggttatcactcggtgattgat |
91 |
Q |
| |
|
|||||| |||||| | |||| ||| |||||||||||||| || ||||||||| | |||||||||| | ||||||| |
|
|
| T |
14470477 |
gctaaaggtacaattactctaatggtaaaaggtggtgtcgaatctattgttgttagttatcactcagagattgat |
14470403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 81
Target Start/End: Original strand, 47569342 - 47569408
Alignment:
| Q |
15 |
ctgctaaaagtacaactgctcttatgataaaaggtggtgtcaaacctattgttgctggttatcactc |
81 |
Q |
| |
|
|||||||| || || ||||| | |||||||||||| |||||||||||| || |||| |||||||||| |
|
|
| T |
47569342 |
ctgctaaatgtgcagctgctttgatgataaaaggtagtgtcaaacctaatgctgctagttatcactc |
47569408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 38 - 78
Target Start/End: Complemental strand, 24621614 - 24621574
Alignment:
| Q |
38 |
atgataaaaggtggtgtcaaacctattgttgctggttatca |
78 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||| ||||||| |
|
|
| T |
24621614 |
atgataaaagctggtgtcaaacctaatgttgcttgttatca |
24621574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 38 - 81
Target Start/End: Complemental strand, 6326578 - 6326535
Alignment:
| Q |
38 |
atgataaaaggtggtgtcaaacctattgttgctggttatcactc |
81 |
Q |
| |
|
||||||||||| ||| ||||||||| ||||||| |||||||||| |
|
|
| T |
6326578 |
atgataaaaggcggtctcaaacctaatgttgctagttatcactc |
6326535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 39 - 78
Target Start/End: Original strand, 23787262 - 23787301
Alignment:
| Q |
39 |
tgataaaaggtggtgtcaaacctattgttgctggttatca |
78 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| ||||||| |
|
|
| T |
23787262 |
tgataaaagctggtgtcaaacctaatgttgcttgttatca |
23787301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 42 - 138
Target Start/End: Original strand, 9066529 - 9066625
Alignment:
| Q |
42 |
taaaaggtggtgtcaaacctattgttgctggttatcactcggtgattgatgaaccatacaaaggagaaggacaaatcgataagattgcacaattggt |
138 |
Q |
| |
|
|||| ||||||||| ||||||||||||||| ||||||||||||||||||| | | || ||||| |||||||||| | ||||||||||||||| |||| |
|
|
| T |
9066529 |
taaacggtggtgtcgaacctattgttgctgtttatcactcggtgattgatcacctattcaaagtagaaggacaagttgataagattgcacaaatggt |
9066625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 38 - 81
Target Start/End: Original strand, 16375426 - 16375469
Alignment:
| Q |
38 |
atgataaaaggtggtgtcaaacctattgttgctggttatcactc |
81 |
Q |
| |
|
||||||||||||||||||||||||| || | || |||||||||| |
|
|
| T |
16375426 |
atgataaaaggtggtgtcaaacctaatgcttctagttatcactc |
16375469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 50 - 133
Target Start/End: Complemental strand, 47924734 - 47924651
Alignment:
| Q |
50 |
ggtgtcaaacctattgttgctggttatcactcggtgattgatgaaccatacaaaggagaaggacaaatcgataagattgcacaa |
133 |
Q |
| |
|
||||||||||||| |||||| |||||||||| ||||||||| ||| ||||| ||| || ||| || | |||||||||||||| |
|
|
| T |
47924734 |
ggtgtcaaacctaatgttgccagttatcactcagtgattgatcaactatacagaggtgatggaaaagttaataagattgcacaa |
47924651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University