View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9348-LTR4-TNT-insertion-4 (Length: 353)
Name: F9348-LTR4-TNT-insertion-4
Description: F9348-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9348-LTR4-TNT-insertion-4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 120 - 316
Target Start/End: Original strand, 6490932 - 6491128
Alignment:
| Q |
120 |
gttacaatccatatagattcatgagtttaactttacccggctagatcattttgggttttggtcgcaaactatgaagaagaaaaaaaacnnnnnnnnnnng |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6490932 |
gttacaatccatatagattcatgagtttaactttacccggctagatcattttgggttttggtcgcaaactatgaagaagaaaaaaaactttttttttttg |
6491031 |
T |
|
| Q |
220 |
aacaaatnnnnnnnnnnnnnccttaattgaactctttgaatttaactgagtcatcaaactgtcagttcgacccatacccatgaactactctaattga |
316 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6491032 |
aacaaataagaaggaaaaaaccttaattgaactctttgaatttaactgagtcatcaaactgtcagttcgactcatacccatgaactactctaattga |
6491128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 7 - 67
Target Start/End: Original strand, 6490819 - 6490879
Alignment:
| Q |
7 |
agtacataaagctggacatagatagtgtaacaatcctttgtcttcatttaattacttatga |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6490819 |
agtacataaagctggacatagatagtgtaacaatcctttgtcttcatttaattacttatga |
6490879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 376 times since January 2019
Visitors: 969