View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9349-LTR4-TNT-insertion-3 (Length: 207)
Name: F9349-LTR4-TNT-insertion-3
Description: F9349-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9349-LTR4-TNT-insertion-3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 67 - 199
Target Start/End: Complemental strand, 43598400 - 43598268
Alignment:
| Q |
67 |
gtacaccataagaggctaaaatactaaaattcatggcagttcatcatggttgaattaaactagtaatagtttcatcttgttcaattgcattcatcatgac |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43598400 |
gtacaccataagaggctaaaatactaaaattcatggcagttcatcatggttgaattaaactagtaatagtttcatcttgttcaattgcattcatcatgac |
43598301 |
T |
|
| Q |
167 |
aaagtcttgattagtcagtaactttagaaatta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43598300 |
aaagtcttgattagtcagtaactttagaaatta |
43598268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 371 times since January 2019
Visitors: 969