View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9350-LTR4-TNT-insertion-7 (Length: 162)
Name: F9350-LTR4-TNT-insertion-7
Description: F9350-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9350-LTR4-TNT-insertion-7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 10 - 152
Target Start/End: Complemental strand, 28811838 - 28811696
Alignment:
Q |
10 |
ataaaattagaatgtgaaagaagctcttcttggttcttaccttatcttatctgattcaaagataatgacgccaattgaatggacaacacaaatttgcgtg |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28811838 |
ataaaattagaatgtgaaagaagctcttcttggttcttaccttatcttatctgattcaaagataatgacgccaattgaatggacaacacaaatttgcgtg |
28811739 |
T |
 |
Q |
110 |
ccctgacttattaaactgaattgaaatccactagaataaatta |
152 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28811738 |
ccctgacttattaaactgaattgaaatccactagaataaatta |
28811696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University