View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9353-LTR4-TNT-insertion-1 (Length: 116)
Name: F9353-LTR4-TNT-insertion-1
Description: F9353-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9353-LTR4-TNT-insertion-1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 2e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 2e-49
Query Start/End: Original strand, 8 - 106
Target Start/End: Complemental strand, 1185130 - 1185032
Alignment:
Q |
8 |
actttttcttacattaagtgccgtagtatggtttctatacggttttgttaaaagggatatttgcatttatgtaagtatataatgtattaaattaaatta |
106 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1185130 |
actttttcttacattaagtgccgtagtatggtttctatacggttttgttaaaagggatatttgcatttatgtaagtatataatgtattaaattaaatta |
1185032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University