View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9353-LTR4-TNT-insertion-2 (Length: 241)
Name: F9353-LTR4-TNT-insertion-2
Description: F9353-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9353-LTR4-TNT-insertion-2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 10 - 231
Target Start/End: Original strand, 31422490 - 31422711
Alignment:
| Q |
10 |
aattgttgggtcagaacgattagatggagaataaccctgcatcaatatctaatgttttcatcttgtcaaaacnnnnnnnntctaatgttttcaccataat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31422490 |
aattgttgggtcagaacgattagatggagaataaccctgcatcaatatctaatgttttcatcttgtcaaaacaaaaaaaatctaatgttttcaccataat |
31422589 |
T |
 |
| Q |
110 |
ttattcacatgaagagcgtatagtgcatcttcaaggggagcattgtctctgaatggatcacctttctgctatggtaaacaaacataaatactcaaatgtg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31422590 |
ttattcacatgaagagcgtatagtgcatcttcaaggggagcattgtctctgaatggatcacctttctgctatggtaaacaaacataaatactcaaatgtg |
31422689 |
T |
 |
| Q |
210 |
atcacgttatctaaaagcatta |
231 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31422690 |
atcacgttatctaaaagcatta |
31422711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University