View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9353-LTR4-TNT-insertion-8 (Length: 206)
Name: F9353-LTR4-TNT-insertion-8
Description: F9353-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9353-LTR4-TNT-insertion-8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 10 - 196
Target Start/End: Complemental strand, 37657959 - 37657773
Alignment:
| Q |
10 |
tcttcctttgatgtggtagaaattttgtcactcttgtgataacttagctgaacttctctatgatttttaagctccattggcgcaggagcctcagagtaat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37657959 |
tcttcctttgatgtggtagaaattttgtcactcttgtgataacttagctgaacttctctatgatttttaagctccattggcgcaggagcctcagagtaat |
37657860 |
T |
 |
| Q |
110 |
gaacatcttccatggcttgaagtgctaccaagaagatatgagttatcaagagaaaaaccaagccaactttgctcattgtgaacatta |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37657859 |
gaacatcttccatggcttgaagtgctaccaagaagatatgagttatcaagagaaaaaccaagccaactttgctcattgtgaacatta |
37657773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University