View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9354-LTR4-TNT-insertion-3 (Length: 62)
Name: F9354-LTR4-TNT-insertion-3
Description: F9354-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9354-LTR4-TNT-insertion-3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 45; Significance: 2e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 36994932 - 36994888
Alignment:
Q |
8 |
catatgtggcttaagcatagcaggccaacctatatgttgtgaatt |
52 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36994932 |
catatgtggcttaagcatagcaggccaacctatatgttgtgaatt |
36994888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 42
Target Start/End: Complemental strand, 36994855 - 36994824
Alignment:
Q |
11 |
atgtggcttaagcatagcaggccaacctatat |
42 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
36994855 |
atgtggcttaagcatagcaggccaacctatat |
36994824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University