View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9355-LTR4-TNT-insertion-1 (Length: 261)
Name: F9355-LTR4-TNT-insertion-1
Description: F9355-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9355-LTR4-TNT-insertion-1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 9 - 252
Target Start/End: Original strand, 6443754 - 6443997
Alignment:
| Q |
9 |
ggtttaccttctaaagcagctgtaacactgaaagtcaataactgccttcatacccaaagacaaaagaaagtcatgtaagatcatatcttctagtttatta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6443754 |
ggtttaccttctaaagcagctgtaacactgaaagtcaataactgccttcatacccaaagacaaaagaaagtcatgtaagatcatatcttctagtttatta |
6443853 |
T |
|
| Q |
109 |
gcaacttgctaaattaatatttcatattgttgcccttacatcacatgtgtcaccaattcgccatctacatctacgacaacttgcttccgacagttatttg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6443854 |
gcaacttgctaaattaatatttcatattgttgcccttacatcacatgtgtcaccaattcgccatctacatctacgacaacttgcttccgacagttatttg |
6443953 |
T |
|
| Q |
209 |
atgaaagttccttggctgctgtaaatctttataaccaacaattg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6443954 |
atgaaagttccttggctgctgtaaatctttataaccaacaattg |
6443997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 334 times since January 2019
Visitors: 967