View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9355-LTR4-TNT-insertion-5 (Length: 383)
Name: F9355-LTR4-TNT-insertion-5
Description: F9355-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9355-LTR4-TNT-insertion-5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 9 - 375
Target Start/End: Original strand, 306305 - 306672
Alignment:
| Q |
9 |
catatttatggcattcatgtgataattttaagtttatttaatatgctaattggttgggaaaatgtgaagatggcaacagaagcnnnnnnnnnn-atacac |
107 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
306305 |
catatttatggcattcatgtgataattctaagtttatttaatatgctaattggttgggaaaatgtgaagatggcaacagaagctttttttttttatacac |
306404 |
T |
 |
| Q |
108 |
tttttggtagtgtgtttatggggtcttatcatttaacatgatgagacttactttacaatcaatcggtgattggaggctcaatctcgtgaccgaaaaactt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
306405 |
tttttggtagtgtgtttatggggtcttatcatttaacatgatgagacttactttacaatcaatcggtgattggaggctcaatctcgtgaccgaaaaactt |
306504 |
T |
 |
| Q |
208 |
aacaggagcatgccttccagatatgtattgtattggttattggttataggtaactactttatgtgatattgtttataatccgattcatatatagtcatgg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
306505 |
aacaggagcatgccttccagatatgtattgtattggttattggttataggtaactactttatgtgatattgtttataatccgattcatatatagtcatgg |
306604 |
T |
 |
| Q |
308 |
ccttaatagcattcacatggatccgttctacaatggcgtataataatttgaaacaaccattttaatta |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
306605 |
ccttaatagcattcacatggatccgttctacaatggcgtataataatttgaaacaaccattttaatta |
306672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University