View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9356-LTR4-TNT-insertion-12 (Length: 253)
Name: F9356-LTR4-TNT-insertion-12
Description: F9356-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9356-LTR4-TNT-insertion-12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 9 - 243
Target Start/End: Original strand, 2245728 - 2245962
Alignment:
| Q |
9 |
tacagaggagtgagacagagacactggggaaaatgggtggctgagattagacttcctcagaatagaatgagagtttggcttggaacttatgaaactgctg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2245728 |
tacagaggagtgagacagagacactggggaaaatgggtggctgagattagacttcctcagaatagaatgagagtttggcttggaacttatgaaactgctg |
2245827 |
T |
|
| Q |
109 |
aagctgcagcttatgcttatgatcgtgcagcttataagcttcgaggcgaatacgcgcgtttaaattttccaaatttgaaagatccaactaagttgggttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2245828 |
aagctgcagcttatgcttatgatcgtgcagcttataagcttcgaggcgaatacgcgcgtttaaattttccaaatttgaaagatccaactaagttgggttt |
2245927 |
T |
|
| Q |
209 |
tggagattctactagattgaatgctttgaagaatt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2245928 |
tggagattctactagattgaatgctttgaagaatt |
2245962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 27 - 144
Target Start/End: Original strand, 25985946 - 25986063
Alignment:
| Q |
27 |
agacactggggaaaatgggtggctgagattagacttcctcagaatagaatgagagtttggcttggaacttatgaaactgctgaagctgcagcttatgctt |
126 |
Q |
| |
|
||||| |||||||||||||| |||||||| ||||| || ||||||||| || |||||||||| |||| ||| |||||||||| || |||| |||| |
|
|
| T |
25985946 |
agacattggggaaaatgggttgctgagataagactacccaagaatagaacaaggctttggcttggtacttttgacactgctgaagaagctgctttggctt |
25986045 |
T |
|
| Q |
127 |
atgatcgtgcagcttata |
144 |
Q |
| |
|
||||| | || ||||||| |
|
|
| T |
25986046 |
atgatagagctgcttata |
25986063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 9 - 148
Target Start/End: Original strand, 33469902 - 33470041
Alignment:
| Q |
9 |
tacagaggagtgagacagagacactggggaaaatgggtggctgagattagacttcctcagaatagaatgagagtttggcttggaacttatgaaactgctg |
108 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||| |||||||| ||||| ||| |||| ||| ||| | |||||||| |||| ||| || |||| |
|
|
| T |
33469902 |
tacagaggagtgagacaaaggcactggggaaaatgggttgctgagataagactacctaagaaccgaacaagattatggcttggtacttttgacacagctg |
33470001 |
T |
|
| Q |
109 |
aagctgcagcttatgcttatgatcgtgcagcttataagct |
148 |
Q |
| |
|
||| ||||||| ||||||||| || ||||||||||| |
|
|
| T |
33470002 |
aagaagcagctttggcttatgataaagctgcttataagct |
33470041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 45
Target Start/End: Original strand, 6568884 - 6568924
Alignment:
| Q |
5 |
acactacagaggagtgagacagagacactggggaaaatggg |
45 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
6568884 |
acactatagaggagtgagacagagaccatggggaaaatggg |
6568924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 56
Target Start/End: Original strand, 33718963 - 33719007
Alignment:
| Q |
12 |
agaggagtgagacagagacactggggaaaatgggtggctgagatt |
56 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
33718963 |
agaggagtgagacagagaccatggggaaaatgggctgctgagatt |
33719007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 418 times since January 2019
Visitors: 972