View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9356-LTR4-TNT-insertion-13 (Length: 64)
Name: F9356-LTR4-TNT-insertion-13
Description: F9356-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9356-LTR4-TNT-insertion-13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 45; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 33450152 - 33450108
Alignment:
Q |
10 |
cgatgcaataaaatatcaaatagttgtgtcgttcatcttagaatt |
54 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33450152 |
cgatgcaataaaatatcaaatagttgtgtcgttcatcttagaatt |
33450108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 49
Target Start/End: Original strand, 18822063 - 18822102
Alignment:
Q |
10 |
cgatgcaataaaatatcaaatagttgtgtcgttcatctta |
49 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
T |
18822063 |
cgatgcaataaaatatcagttagttgtgtcgttcatctta |
18822102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University