View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9356-LTR4-TNT-insertion-2 (Length: 84)
Name: F9356-LTR4-TNT-insertion-2
Description: F9356-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9356-LTR4-TNT-insertion-2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 5e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 8 - 75
Target Start/End: Complemental strand, 11232251 - 11232184
Alignment:
Q |
8 |
ccacaggcttgggtttagttcacacagtaatcaatcatatgcagaagcaaacaattaagtatcaattg |
75 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11232251 |
ccacaggcttgggtttagttcacacagtaatcaatcatatgcagaagcaaacaattaagtatcaattg |
11232184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 7e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 7e-18
Query Start/End: Original strand, 10 - 75
Target Start/End: Original strand, 48900347 - 48900412
Alignment:
Q |
10 |
acaggcttgggtttagttcacacagtaatcaatcatatgcagaagcaaacaattaagtatcaattg |
75 |
Q |
|
|
|||||||| ||||||| | ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
48900347 |
acaggcttaggtttagcttacacagtaatcaagaatatgcagaagcaaacaattaagtatcaattg |
48900412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 367 times since January 2019
Visitors: 969