View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9356-LTR4-TNT-insertion-4 (Length: 173)
Name: F9356-LTR4-TNT-insertion-4
Description: F9356-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9356-LTR4-TNT-insertion-4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 7 - 130
Target Start/End: Complemental strand, 38132683 - 38132560
Alignment:
| Q |
7 |
attattcgagtcacataaaattataatgagctgtaaagctctcatgcaatattaaaactttttagatgtgaacttgagagagatcagtcttcaattgtgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38132683 |
attattcgagtcacataaaattataatgagctgtaaagctctcatgcaatattaaaactttttagatgtgaacttgagagagatcagtcttcaattgtgt |
38132584 |
T |
|
| Q |
107 |
atggaaaaaactagttatttacgg |
130 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38132583 |
atggaaaaaactagttatttacgg |
38132560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 291 times since January 2019
Visitors: 964