View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9356-LTR4-TNT-insertion-6 (Length: 52)
Name: F9356-LTR4-TNT-insertion-6
Description: F9356-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9356-LTR4-TNT-insertion-6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 35; Significance: 0.00000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 10 - 44
Target Start/End: Original strand, 36599354 - 36599388
Alignment:
| Q |
10 |
aattgaagtgtactgttataaacttatgagcatta |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36599354 |
aattgaagtgtactgttataaacttatgagcatta |
36599388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 463 times since January 2019
Visitors: 980