View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9360-LTR4-TNT-insertion-4 (Length: 52)
Name: F9360-LTR4-TNT-insertion-4
Description: F9360-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9360-LTR4-TNT-insertion-4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 36; Significance: 0.000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.000000000003
Query Start/End: Original strand, 7 - 42
Target Start/End: Original strand, 20462475 - 20462510
Alignment:
Q |
7 |
atatctcaaattttatcaacggtgataataaaatta |
42 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
20462475 |
atatctcaaattttatcaacggtgataataaaatta |
20462510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University