View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9361-LTR4-TNT-insertion-11 (Length: 57)
Name: F9361-LTR4-TNT-insertion-11
Description: F9361-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9361-LTR4-TNT-insertion-11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 41; Significance: 0.000000000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.000000000000004
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 47197199 - 47197239
Alignment:
Q |
8 |
aaagcaactactgcaaatatgacaatcagaagcttcaattg |
48 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47197199 |
aaagcaactactgcaaatatgacaatcagaagcttcaattg |
47197239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University