View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9361-LTR4-TNT-insertion-2 (Length: 371)
Name: F9361-LTR4-TNT-insertion-2
Description: F9361-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9361-LTR4-TNT-insertion-2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 8 - 361
Target Start/End: Complemental strand, 30262100 - 30261747
Alignment:
| Q |
8 |
gccgacacaccaaagaagttgaaccaggaaatcccagttgatgctagcctatcgaattggttgggttcatccgggacgactacacctgttaacaaggctt |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30262100 |
gccggcacaccaaagaagttgaaccaggaaatcccagttgatgctagcctatcgaattggttgggttcatccgggacgactacacctgttaacaaggctt |
30262001 |
T |
|
| Q |
108 |
gtttgtatgctggtggtggtattggtactcctgataggagcatctcacaacaaggttcaaattcagtgataagccttgaagataggcctattttaggtgc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30262000 |
gtttgtatgctggtggtggtattggtactcctgataggagcatctcacaacaaggttcaaattcagtgataagccttgaagataggcctattttaggtgc |
30261901 |
T |
|
| Q |
208 |
tttaacaatggaagagattaagcaattttccgctacgtcgtccccaaggaagtcaccttgtaagagtccagacgagatgccgattataggaacagttggg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30261900 |
tttaacaatggaagagattaagcaattttccgctacgtcgtccccaaggaagtcaccttgtaagagtccagatgagatgccgattataggaacagttggg |
30261801 |
T |
|
| Q |
308 |
tcctattggaatgctaatgagggttctggctcaccttcatcctttaaaggaatt |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30261800 |
tcctattggaatgctaatgagggttctggctcaccttcatcctttaaaggaatt |
30261747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 455 times since January 2019
Visitors: 979