View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9361-LTR4-TNT-insertion-20 (Length: 358)
Name: F9361-LTR4-TNT-insertion-20
Description: F9361-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9361-LTR4-TNT-insertion-20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 78 - 303
Target Start/End: Original strand, 2927145 - 2927370
Alignment:
| Q |
78 |
gcgtctccgtacgtattattgtggaagggttttagggcttttgaggcataacagtttttatggggtttatgcgctgatttgacagatttacccnnnnnnn |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2927145 |
gcgtctccgtacgtattattgtggaagggttttagggcttttgaggcataacagtttttatggggtttatgcgctgatttgacagatttacccttttttt |
2927244 |
T |
 |
| Q |
178 |
gacttgagggagaagttaggactgcatatataacgcgtgttaattgccaagcaacaaacacgactccgcaattttatattttctgctcttgttccttcaa |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2927245 |
gacttgagggagaagttaggactgcatatataacgcgtgttaattgccaagcaacaaacacgactccgcaattttatattttctgctcttgttccttcaa |
2927344 |
T |
 |
| Q |
278 |
aataatatttttgtgcttttgttaac |
303 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2927345 |
aataatatttttgtgcttttgttaac |
2927370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 8 - 45
Target Start/End: Original strand, 2927075 - 2927112
Alignment:
| Q |
8 |
aggttatggagaagggatgtgtgagtccacttttgtgg |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2927075 |
aggttatggagaagggatgtgtgagtccacttttgtgg |
2927112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University