View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9361-LTR4-TNT-insertion-21 (Length: 134)
Name: F9361-LTR4-TNT-insertion-21
Description: F9361-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9361-LTR4-TNT-insertion-21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 7e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 7e-47
Query Start/End: Original strand, 30 - 124
Target Start/End: Complemental strand, 8338504 - 8338410
Alignment:
| Q |
30 |
tcacttgattatagacaatgttgaaataaatttttgaataagccaaaaataatatcaaaaggaataaatatgagcttgacggaaactgaagatta |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8338504 |
tcacttgattatagacaatgttgaaataaatttttgaataagccaaaaataatatcaaaaggaataaatatgagcttgacggaaactgaagatta |
8338410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 30 - 114
Target Start/End: Original strand, 15576124 - 15576208
Alignment:
| Q |
30 |
tcacttgattatagacaatgttgaaataaatttttgaataagccaaaaataatatcaaaaggaataaatatgagcttgacggaaa |
114 |
Q |
| |
|
|||| ||||||| ||||||||| ||||||||||||||||||| ||||||||| |||| ||||||| | ||| |||||| ||||| |
|
|
| T |
15576124 |
tcacatgattatcgacaatgttcaaataaatttttgaataagtcaaaaataagatcaccaggaatacagatgtgcttgatggaaa |
15576208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University