View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9361-LTR4-TNT-insertion-6 (Length: 306)
Name: F9361-LTR4-TNT-insertion-6
Description: F9361-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9361-LTR4-TNT-insertion-6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 156 - 284
Target Start/End: Complemental strand, 1186009 - 1185881
Alignment:
| Q |
156 |
tgatggatggatggataccttgccctagcgagtggcggtttccgtctcgattgacttctgggaaagaaattcgcggccgccgcctgaggtaggaagggag |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1186009 |
tgatggatggatggataccttgccctagcgagtggcggtttccgtctcgattgacttctgggaaagaaattcgcggccgccgcctgaggtaggaagggag |
1185910 |
T |
|
| Q |
256 |
gatagacaatgtatgtgtttgcgcaattg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1185909 |
gatagacaatgtatgtgtttgcgcaattg |
1185881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 9 - 120
Target Start/End: Complemental strand, 1186156 - 1186045
Alignment:
| Q |
9 |
tactttgccttcgtgtctgtgtctccaccattgttgtctgacaagaaaagaaaattgaaatgaaatgaaattcattgattagaaacgaattaatagttat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1186156 |
tactttgccttcgtgtctgtgtctccaccattgttgtctgacaagaaaagaaaattgaaatgaaatgaaattcattgattagaaacgaattaatagttat |
1186057 |
T |
|
| Q |
109 |
cctaacctaatt |
120 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1186056 |
cctaacctaatt |
1186045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 527 times since January 2019
Visitors: 990