View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9365-LTR4-TNT-insertion-8 (Length: 184)

Name: F9365-LTR4-TNT-insertion-8
Description: F9365-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9365-LTR4-TNT-insertion-8
F9365-LTR4-TNT-insertion-8
[»] chr3 (12 HSPs)
chr3 (27-175)||(16768628-16768776)
chr3 (34-127)||(40160755-40160853)
chr3 (29-85)||(3993730-3993787)
chr3 (98-127)||(24136729-24136758)
chr3 (64-127)||(33528182-33528249)
chr3 (40-96)||(43774211-43774268)
chr3 (33-96)||(3973321-3973385)
chr3 (33-96)||(3996491-3996555)
chr3 (38-85)||(19137643-19137691)
chr3 (45-123)||(46328907-46328988)
chr3 (34-96)||(24130579-24130642)
chr3 (97-124)||(45118730-45118757)
[»] chr8 (9 HSPs)
chr8 (50-127)||(39165017-39165097)
chr8 (81-127)||(8402286-8402335)
chr8 (33-96)||(17467297-17467360)
chr8 (64-119)||(43508435-43508492)
chr8 (33-96)||(26657875-26657940)
chr8 (27-127)||(43001234-43001340)
chr8 (40-96)||(3379660-3379715)
chr8 (33-92)||(29937229-29937289)
chr8 (34-96)||(22847274-22847337)
[»] chr1 (14 HSPs)
chr1 (64-127)||(32635191-32635257)
chr1 (33-96)||(50199488-50199552)
chr1 (70-127)||(32660887-32660947)
chr1 (34-96)||(9768821-9768884)
chr1 (40-96)||(21884601-21884658)
chr1 (40-127)||(29491496-29491585)
chr1 (40-127)||(50859346-50859436)
chr1 (33-96)||(1721159-1721223)
chr1 (33-94)||(12553212-12553275)
chr1 (34-97)||(18003836-18003900)
chr1 (40-96)||(32711156-32711212)
chr1 (34-96)||(3341748-3341811)
chr1 (34-96)||(3553293-3553356)
chr1 (36-94)||(52961096-52961155)
[»] chr7 (12 HSPs)
chr7 (40-127)||(29658251-29658341)
chr7 (27-96)||(11808051-11808121)
chr7 (40-123)||(21285336-21285422)
chr7 (40-127)||(5787487-5787577)
chr7 (40-96)||(22965970-22966027)
chr7 (40-96)||(30644195-30644252)
chr7 (40-95)||(23685567-23685623)
chr7 (34-93)||(47355829-47355889)
chr7 (99-126)||(8859806-8859833)
chr7 (99-126)||(8875681-8875708)
chr7 (27-62)||(32834350-32834385)
chr7 (100-127)||(41139176-41139203)
[»] chr4 (10 HSPs)
chr4 (33-96)||(42758176-42758239)
chr4 (34-92)||(20166336-20166395)
chr4 (77-127)||(46206652-46206705)
chr4 (34-125)||(49039424-49039520)
chr4 (40-123)||(26708536-26708620)
chr4 (64-123)||(30295564-30295625)
chr4 (64-123)||(30324466-30324527)
chr4 (34-96)||(20610759-20610822)
chr4 (34-96)||(37997858-37997921)
chr4 (100-127)||(42411432-42411459)
[»] chr2 (8 HSPs)
chr2 (40-127)||(29035002-29035092)
chr2 (33-94)||(36413779-36413841)
chr2 (40-96)||(3037634-3037691)
chr2 (40-96)||(30474207-30474264)
chr2 (37-96)||(18089752-18089812)
chr2 (29-96)||(44487779-44487847)
chr2 (50-127)||(5207129-5207210)
chr2 (100-127)||(15625264-15625291)
[»] scaffold0809 (1 HSPs)
scaffold0809 (40-127)||(4785-4874)
[»] chr5 (10 HSPs)
chr5 (64-127)||(42355724-42355791)
chr5 (40-96)||(27025441-27025498)
chr5 (29-96)||(18101961-18102029)
chr5 (64-124)||(18175258-18175322)
chr5 (34-92)||(25660932-25660991)
chr5 (34-96)||(31556838-31556901)
chr5 (29-127)||(35813220-35813322)
chr5 (27-127)||(28537148-28537253)
chr5 (40-96)||(33800919-33800976)
chr5 (34-96)||(3535948-3536011)
[»] chr6 (6 HSPs)
chr6 (40-123)||(25020511-25020597)
chr6 (40-123)||(5134417-5134503)
chr6 (29-92)||(5544291-5544355)
chr6 (34-97)||(34524895-34524959)
chr6 (34-96)||(8309184-8309247)
chr6 (34-92)||(30833037-30833096)
[»] scaffold0032 (1 HSPs)
scaffold0032 (97-127)||(41987-42017)


Alignment Details
Target: chr3 (Bit Score: 104; Significance: 4e-52; HSPs: 12)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 104; E-Value: 4e-52
Query Start/End: Original strand, 27 - 175
Target Start/End: Complemental strand, 16768776 - 16768628
Alignment:
27 aattgatagggacatgcattgtaatatgcaggggcctggttggaaccccagacaccccacgtattcacctgaggtgaatttctagccactaggctacttg 126  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16768776 aattgatagggacatgcattgtaatatgcaggggcctggttggaaccccagacaccccacgtattcacctgaggtgaatttctagccactaggctacttg 16768677  T
127 agcnnnnnnnnnnnnnnnttatttaagttaaactttcacagtgcaattg 175  Q
    |||               |||||||||||||||||||||||||||||||    
16768676 agcaaaaaattaaaaaaattatttaagttaaactttcacagtgcaattg 16768628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 34 - 127
Target Start/End: Original strand, 40160755 - 40160853
Alignment:
34 agggacatgcattgtaatatgcaggggc-ctggttggaaccccagacaccccacgtattcacct-----gaggtgaatttctagccactaggctacttga 127  Q
    ||||||||||||||| |||||| |||||   |||| ||||||| |||||||||| |||||||||      ||||||| ||||||||||||||||||||||    
40160755 agggacatgcattgttatatgccggggctggggtttgaaccccggacaccccacttattcacctttaaaaaggtgaa-ttctagccactaggctacttga 40160853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 3993787 - 3993730
Alignment:
29 ttgatagggacatgcattgtaatatgcaggggcc-tggttggaaccccagacacccca 85  Q
    |||| ||||||||||||||| |||||||||||||  |||| ||||||| |||||||||    
3993787 ttgagagggacatgcattgttatatgcaggggccgcggtttgaaccccggacacccca 3993730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 98 - 127
Target Start/End: Complemental strand, 24136758 - 24136729
Alignment:
98 aggtgaatttctagccactaggctacttga 127  Q
    ||||||||||||||||||||||||||||||    
24136758 aggtgaatttctagccactaggctacttga 24136729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 64 - 127
Target Start/End: Complemental strand, 33528249 - 33528182
Alignment:
64 ggttggaaccccagacaccccacgtattcacc--tgaggtgaatt--tctagccactaggctacttga 127  Q
    |||| |||||||||||||||||| |||||| |  | |||||||||  |||||||||||||||||||||    
33528249 ggttcgaaccccagacaccccacttattcatctttaaggtgaatttctctagccactaggctacttga 33528182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 40 - 96
Target Start/End: Original strand, 43774211 - 43774268
Alignment:
40 atgcattgtaatatgcaggggcctgg-ttggaaccccagacaccccacgtattcacct 96  Q
    ||||||||| ||||||||||| | || || |||||||||||||||||| |||||||||    
43774211 atgcattgttatatgcaggggtcggggttcgaaccccagacaccccacttattcacct 43774268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 33 - 96
Target Start/End: Original strand, 3973321 - 3973385
Alignment:
33 tagggacatgcattgtaatatgcaggggcc-tggttggaaccccagacaccccacgtattcacct 96  Q
    |||||||||||||||| |||||||||||||  | || ||||||| |||||||||  |||||||||    
3973321 tagggacatgcattgttatatgcaggggccgcgatttgaaccccggacaccccatttattcacct 3973385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 33 - 96
Target Start/End: Complemental strand, 3996555 - 3996491
Alignment:
33 tagggacatgcattgtaatatgcaggggcc-tggttggaaccccagacaccccacgtattcacct 96  Q
    |||||||||||||||| |||||||||||||  | || ||||||| |||||||||  |||||||||    
3996555 tagggacatgcattgttatatgcaggggccgcgatttgaaccccggacaccccatttattcacct 3996491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 38 - 85
Target Start/End: Original strand, 19137643 - 19137691
Alignment:
38 acatgcattgtaatatgcaggggcc-tggttggaaccccagacacccca 85  Q
    ||||||||||| |||||||||||||  |||| |||||||||||||||||    
19137643 acatgcattgttatatgcaggggccgaggttcgaaccccagacacccca 19137691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 45 - 123
Target Start/End: Complemental strand, 46328988 - 46328907
Alignment:
45 ttgtaatatgcaggggcctgg-ttggaaccccagacaccccacgtattcacctga---ggtgaatttctagccactaggctac 123  Q
    |||| ||||||||||||| || || ||||||| |||||||||| ||||||||| |   |||||||| ||||||||||||||||    
46328988 ttgttatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt-ctagccactaggctac 46328907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 34 - 96
Target Start/End: Original strand, 24130579 - 24130642
Alignment:
34 agggacatgcattgtaatatgcagggg-cctggttggaaccccagacaccccacgtattcacct 96  Q
    |||||||| |||||| ||||||||||| |  |||| ||||||| |||||||||| |||||||||    
24130579 agggacatacattgttatatgcaggggacggggtttgaaccccggacaccccacttattcacct 24130642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 97 - 124
Target Start/End: Original strand, 45118730 - 45118757
Alignment:
97 gaggtgaatttctagccactaggctact 124  Q
    ||||||||||||||||||||||||||||    
45118730 gaggtgaatttctagccactaggctact 45118757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 9)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 50 - 127
Target Start/End: Original strand, 39165017 - 39165097
Alignment:
50 atatgcaggggcctggttggaaccccagacaccccacgtattcacct---gaggtgaatttctagccactaggctacttga 127  Q
    ||||||| ||||| |||| |||| || |||||||||| |||||||||   |||||||||||||||||||||||||||||||    
39165017 atatgcaagggccgggttcgaacaccggacaccccacttattcaccttaagaggtgaatttctagccactaggctacttga 39165097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 81 - 127
Target Start/End: Complemental strand, 8402335 - 8402286
Alignment:
81 ccccacgtattcacct---gaggtgaatttctagccactaggctacttga 127  Q
    |||||| |||||||||   |||||||||||||||||||||||||||||||    
8402335 ccccacttattcaccttaagaggtgaatttctagccactaggctacttga 8402286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 33 - 96
Target Start/End: Original strand, 17467297 - 17467360
Alignment:
33 tagggacatgcattgtaatatgcaggggcctggttggaaccccagacaccccacgtattcacct 96  Q
    |||||| || |||| | ||||||||||||| |||| ||||||| |||||||||| |||||||||    
17467297 tagggatatacattattatatgcaggggccgggttcgaaccccggacaccccacttattcacct 17467360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 119
Target Start/End: Complemental strand, 43508492 - 43508435
Alignment:
64 ggttggaaccccagacaccccacgtattcacctga--ggtgaatttctagccactagg 119  Q
    |||| ||||||| |||||||||| ||||||||| |  |||||||||||||||||||||    
43508492 ggtttgaaccccggacaccccacttattcaccttaaaggtgaatttctagccactagg 43508435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 33 - 96
Target Start/End: Original strand, 26657875 - 26657940
Alignment:
33 tagggacatgcattgtaatatgcaggggcc-tggttggaaccccagaca-ccccacgtattcacct 96  Q
    |||||||||||||||| |||||||||| ||  |||| |||||||||||| |||||| |||||||||    
26657875 tagggacatgcattgttatatgcagggaccggggttcgaaccccagacacccccacttattcacct 26657940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 27 - 127
Target Start/End: Original strand, 43001234 - 43001340
Alignment:
27 aattgatagggaca-tgcattgtaatatgcaggggcctgg-ttggaaccccagacaccccacgtattcacct----gaggtgaatttctagccactaggc 120  Q
    ||||| |||||||| |||||||||||||||| | ||| || || ||||||| ||||| |||  |||||||||    ||||||||||||||||| ||| ||    
43001234 aattggtagggacaatgcattgtaatatgcatgtgccagggtttgaaccccggacactccatttattcacctttaagaggtgaatttctagcctctaagc 43001333  T
121 tacttga 127  Q
    |||||||    
43001334 tacttga 43001340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 3379715 - 3379660
Alignment:
40 atgcattgtaatatgcaggggcctggttggaaccccagacaccccacgtattcacct 96  Q
    ||||||||| ||||||||||||  |||| ||||||| |||||||||| |||||||||    
3379715 atgcattgttatatgcaggggctgggttcgaacccc-gacaccccacttattcacct 3379660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 33 - 92
Target Start/End: Original strand, 29937229 - 29937289
Alignment:
33 tagggacatgcattgtaatatgcaggggcctg-gttggaaccccagacaccccacgtattc 92  Q
    |||||||||| ||||| ||||||||||||| | ||| ||||| |||||||||||| |||||    
29937229 tagggacatgtattgttatatgcaggggccggagttcgaacctcagacaccccacttattc 29937289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 34 - 96
Target Start/End: Complemental strand, 22847337 - 22847274
Alignment:
34 agggacatgcattgtaatatgcagggg-cctggttggaaccccagacaccccacgtattcacct 96  Q
    ||||||||||||||| ||||||||||| |  |||| |||||||| ||||| ||| |||||||||    
22847337 agggacatgcattgttatatgcaggggtcgaggttcgaaccccacacacctcacttattcacct 22847274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 14)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 64 - 127
Target Start/End: Original strand, 32635191 - 32635257
Alignment:
64 ggttggaaccccagacaccccacgtattcacct---gaggtgaatttctagccactaggctacttga 127  Q
    |||| ||||||| |||||||||| |||||||||   |||||||||||||||||||||||||||||||    
32635191 ggttcgaaccccggacaccccacttattcaccttaagaggtgaatttctagccactaggctacttga 32635257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 33 - 96
Target Start/End: Complemental strand, 50199552 - 50199488
Alignment:
33 tagggacatgcattgtaatatgcaggggcc-tggttggaaccccagacaccccacgtattcacct 96  Q
    |||||||||||||||| |||||||||||||  |||| ||||||| |||||||||| |||||||||    
50199552 tagggacatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcacct 50199488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000006
Query Start/End: Original strand, 70 - 127
Target Start/End: Original strand, 32660887 - 32660947
Alignment:
70 aaccccagacaccccacgtattcacct---gaggtgaatttctagccactaggctacttga 127  Q
    |||||| |||||||||| | |||||||   |||||||||||||||||||||||||||||||    
32660887 aaccccggacaccccactttttcaccttaagaggtgaatttctagccactaggctacttga 32660947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 34 - 96
Target Start/End: Complemental strand, 9768884 - 9768821
Alignment:
34 agggacatgcattgtaatatgcagggg-cctggttggaaccccagacaccccacgtattcacct 96  Q
    ||||||||||||||| ||||||||||| |  |||| ||||||| |||||||||| |||||||||    
9768884 agggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcacct 9768821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 40 - 96
Target Start/End: Original strand, 21884601 - 21884658
Alignment:
40 atgcattgtaatatgcaggggcct-ggttggaaccccagacaccccacgtattcacct 96  Q
    ||||||| | |||||||||||||  |||| |||||||||||||||||| |||||||||    
21884601 atgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcacct 21884658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 40 - 127
Target Start/End: Original strand, 29491496 - 29491585
Alignment:
40 atgcattgtaatatgcaggggcctgg-ttggaaccccagacaccccacgtattcacctgag-gtgaatttctagccactaggctacttga 127  Q
    ||||||| | ||||||||||| | || || ||||||| |||||||||| ||||||| | |  ||||||||||||||||||||||| ||||    
29491496 atgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaagtgaatttctagccactaggctatttga 29491585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 40 - 127
Target Start/End: Complemental strand, 50859436 - 50859346
Alignment:
40 atgcattgtaatatgcaggggcctgg-ttggaaccccagacaccccacgtattcacctga---ggtgaatttctagccactaggctacttga 127  Q
    ||||||||  ||||||||||||| || ||  |||||| |||||||||| ||||||||| |   |||||||| ||||||||||||||||||||    
50859436 atgcattgatatatgcaggggccggggttcaaaccccggacaccccacatattcaccttaaaaggtgaatt-ctagccactaggctacttga 50859346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 33 - 96
Target Start/End: Original strand, 1721159 - 1721223
Alignment:
33 tagggacatgcattgtaatatgcaggggcctgg-ttggaaccccagacaccccacgtattcacct 96  Q
    |||| ||||||||||| ||||||||||||| || || ||||||| |||||| ||| |||||||||    
1721159 taggaacatgcattgttatatgcaggggccgggtttcgaaccccggacacctcacttattcacct 1721223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 33 - 94
Target Start/End: Original strand, 12553212 - 12553275
Alignment:
33 tagggacatgcattgtaatatgcaggggcc--tggttggaaccccagacaccccacgtattcac 94  Q
    |||| ||||||||||| |||||||||||||   |||| ||||||| |||||||||| |||||||    
12553212 taggaacatgcattgttatatgcaggggccgggggttcgaaccccggacaccccacttattcac 12553275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 34 - 97
Target Start/End: Original strand, 18003836 - 18003900
Alignment:
34 agggacatgcattgtaatatgcaggggcc-tggttggaaccccagacaccccacgtattcacctg 97  Q
    ||||||||||||||| |||||||||||||  |||| || ||||  ||||||||| ||||||||||    
18003836 agggacatgcattgttatatgcaggggccggggttcgagccccgaacaccccacttattcacctg 18003900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 32711212 - 32711156
Alignment:
40 atgcattgtaatatgcaggggcctggttggaaccccagacaccccacgtattcacct 96  Q
    ||||||| | |||||||||| |  |||| |||||||||||||||||| |||||||||    
32711212 atgcattattatatgcagggccggggttcgaaccccagacaccccacttattcacct 32711156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 34 - 96
Target Start/End: Complemental strand, 3341811 - 3341748
Alignment:
34 agggacatgcattgtaatatgcaggggcc-tggttggaaccccagacaccccacgtattcacct 96  Q
    ||||||||||||| | |||||||||||||  || | ||||||| |||||||||| |||||||||    
3341811 agggacatgcattattatatgcaggggccggggatcgaaccccggacaccccacttattcacct 3341748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 34 - 96
Target Start/End: Complemental strand, 3553356 - 3553293
Alignment:
34 agggacatgcattgtaatatgcaggggcctggttg-gaaccccagacaccccacgtattcacct 96  Q
    ||||||||||||| | ||||| | |||| |||||  ||||||| ||||||||||||||||||||    
3553356 agggacatgcattattatatgtaagggcatggttttgaaccccggacaccccacgtattcacct 3553293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 36 - 94
Target Start/End: Complemental strand, 52961155 - 52961096
Alignment:
36 ggacatgcattgtaatatgcaggggcc-tggttggaaccccagacaccccacgtattcac 94  Q
    ||||||||||||| |||||||||||||  |||| ||||||| ||| |||||| |||||||    
52961155 ggacatgcattgttatatgcaggggccggggttcgaaccccggacgccccacttattcac 52961096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 12)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 40 - 127
Target Start/End: Complemental strand, 29658341 - 29658251
Alignment:
40 atgcattgtaatatgcaggggcctgg-ttggaaccccagacaccccacgtattcacctga---ggtgaatttctagccactaggctacttga 127  Q
    ||||||||| ||||||||||||| || || ||||||| |||||||||| ||||||||| |   |||||||| ||||||||||||||||||||    
29658341 atgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt-ctagccactaggctacttga 29658251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000006
Query Start/End: Original strand, 27 - 96
Target Start/End: Original strand, 11808051 - 11808121
Alignment:
27 aattgatagggacatgcattgtaatatgcagggg-cctggttggaaccccagacaccccacgtattcacct 96  Q
    ||||| |||||||||||||||| ||||||||||| |  |||| ||||||| |||||||||| |||||||||    
11808051 aattggtagggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcacct 11808121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 40 - 123
Target Start/End: Complemental strand, 21285422 - 21285336
Alignment:
40 atgcattgtaatatgcaggggcc-tggttggaaccccagacaccccacgtattcacc---tgaggtgaatttctagccactaggctac 123  Q
    ||||||||| |||||||||||||  |||| ||||||| |||||||||| ||||||||   | ||||||| ||||||||||||||||||    
21285422 atgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaa-ttctagccactaggctac 21285336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 40 - 127
Target Start/End: Original strand, 5787487 - 5787577
Alignment:
40 atgcattgtaatatgcaggggcctgg-ttggaaccccagacaccccacgtattcacctga---ggtgaatttctagccactaggctacttga 127  Q
    ||||||| | ||||||||||||| || || |||||||| ||||||||| ||||||||| |   |||||||| |||| |||||||||||||||    
5787487 atgcattattatatgcaggggccggggtttgaaccccaaacaccccacttattcaccttataaggtgaatt-ctagtcactaggctacttga 5787577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 22966027 - 22965970
Alignment:
40 atgcattgtaatatgcaggggcct-ggttggaaccccagacaccccacgtattcacct 96  Q
    ||||||| | |||||||||||||  |||| |||||||||||||||||| |||||||||    
22966027 atgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcacct 22965970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 40 - 96
Target Start/End: Original strand, 30644195 - 30644252
Alignment:
40 atgcattgtaatatgcaggggcctg-gttggaaccccagacaccccacgtattcacct 96  Q
    ||||||| | ||||||||||||| | ||| |||||||||||||||||| |||||||||    
30644195 atgcattattatatgcaggggccggtgttcgaaccccagacaccccacttattcacct 30644252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 40 - 95
Target Start/End: Complemental strand, 23685623 - 23685567
Alignment:
40 atgcattgtaatatgcaggggcctgg-ttggaaccccagacaccccacgtattcacc 95  Q
    ||||||| | ||||||||||||| || || |||||||||||||||||| ||||||||    
23685623 atgcattattatatgcaggggccggggttcgaaccccagacaccccacttattcacc 23685567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 34 - 93
Target Start/End: Original strand, 47355829 - 47355889
Alignment:
34 agggacatgcattgtaatatgcaggggcc-tggttggaaccccagacaccccacgtattca 93  Q
    ||||| ||||||||| |||||||||||||  |||| |||||||||||| ||||| ||||||    
47355829 agggatatgcattgttatatgcaggggccggggttcgaaccccagacatcccacttattca 47355889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 99 - 126
Target Start/End: Original strand, 8859806 - 8859833
Alignment:
99 ggtgaatttctagccactaggctacttg 126  Q
    ||||||||||||||||||||||||||||    
8859806 ggtgaatttctagccactaggctacttg 8859833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 99 - 126
Target Start/End: Complemental strand, 8875708 - 8875681
Alignment:
99 ggtgaatttctagccactaggctacttg 126  Q
    ||||||||||||||||||||||||||||    
8875708 ggtgaatttctagccactaggctacttg 8875681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 27 - 62
Target Start/End: Complemental strand, 32834385 - 32834350
Alignment:
27 aattgatagggacatgcattgtaatatgcaggggcc 62  Q
    |||||||||| ||||||||||| |||||||||||||    
32834385 aattgataggaacatgcattgttatatgcaggggcc 32834350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 100 - 127
Target Start/End: Original strand, 41139176 - 41139203
Alignment:
100 gtgaatttctagccactaggctacttga 127  Q
    ||||||||||||||||||||||||||||    
41139176 gtgaatttctagccactaggctacttga 41139203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 10)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 96
Target Start/End: Complemental strand, 42758239 - 42758176
Alignment:
33 tagggacatgcattgtaatatgcaggggcctggttggaaccccagacaccccacgtattcacct 96  Q
    |||||||||||||| | ||||||||||||| |||| ||||||  |||||||||| |||||||||    
42758239 tagggacatgcattattatatgcaggggccgggttcgaaccctggacaccccacttattcacct 42758176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 34 - 92
Target Start/End: Original strand, 20166336 - 20166395
Alignment:
34 agggacatgcattgtaatatgcaggggcc-tggttggaaccccagacaccccacgtattc 92  Q
    ||||||||||||||| |||||||||||||  |||| |||||||||| ||||||| |||||    
20166336 agggacatgcattgttatatgcaggggccgaggttcgaaccccagataccccacttattc 20166395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 77 - 127
Target Start/End: Original strand, 46206652 - 46206705
Alignment:
77 gacaccccacgtattcacct---gaggtgaatttctagccactaggctacttga 127  Q
    |||||||||| |||||||||   ||||||||||||||||||||| |||||||||    
46206652 gacaccccacttattcaccttaagaggtgaatttctagccactatgctacttga 46206705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 34 - 125
Target Start/End: Complemental strand, 49039520 - 49039424
Alignment:
34 agggacatgcattgtaatatgcaggggc-ctggttggaaccccagacaccccacgtattcacct-----gaggtgaatttctagccactaggctactt 125  Q
    ||||||||||||||| |||||||||| |   |||| ||||||| |||||||||| |||||||||      ||||||| ||||||||||||||||||||    
49039520 agggacatgcattgttatatgcagggactggggttcgaaccccggacaccccacttattcaccttgaaaaaggtgaa-ttctagccactaggctactt 49039424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 40 - 123
Target Start/End: Complemental strand, 26708620 - 26708536
Alignment:
40 atgcattgtaatatgcaggggcctggttggaaccccagacaccccacgtattcacctgag-gtgaatttctagccactaggctac 123  Q
    ||||||| | |||||||||||   |||| ||||| |||||||| ||| ||||||| | |  ||||||||||||||||||||||||    
26708620 atgcattattatatgcaggggttgggttcgaacctcagacacctcacctattcactttaaagtgaatttctagccactaggctac 26708536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 64 - 123
Target Start/End: Original strand, 30295564 - 30295625
Alignment:
64 ggttggaaccccagacaccccacgtattcacct---gaggtgaatttctagccactaggctac 123  Q
    |||| |||||||||||||||||| |||||||||    ||||||| ||||||||||||||||||    
30295564 ggttcgaaccccagacaccccacttattcaccttagaaggtgaa-ttctagccactaggctac 30295625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 64 - 123
Target Start/End: Original strand, 30324466 - 30324527
Alignment:
64 ggttggaaccccagacaccccacgtattcacct---gaggtgaatttctagccactaggctac 123  Q
    |||| |||||||||||||||||| |||||||||    ||||||| ||||||||||||||||||    
30324466 ggttcgaaccccagacaccccacttattcaccttagaaggtgaa-ttctagccactaggctac 30324527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 34 - 96
Target Start/End: Original strand, 20610759 - 20610822
Alignment:
34 agggacatgcattgtaatatgcaggggcc-tggttggaaccccagacaccccacgtattcacct 96  Q
    ||||||||||||||| |||||||||||||  |||| |||| || |||| ||||| |||||||||    
20610759 agggacatgcattgttatatgcaggggccggggttcgaactccggacatcccacttattcacct 20610822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 34 - 96
Target Start/End: Complemental strand, 37997921 - 37997858
Alignment:
34 agggacatgcattgtaatatgcaggggcctgg-ttggaaccccagacaccccacgtattcacct 96  Q
    |||||||| |||||| |||||||||| |  || || |||||||||||||||||| |||||||||    
37997921 agggacattcattgttatatgcagggtctggggttcgaaccccagacaccccacttattcacct 37997858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 100 - 127
Target Start/End: Complemental strand, 42411459 - 42411432
Alignment:
100 gtgaatttctagccactaggctacttga 127  Q
    ||||||||||||||||||||||||||||    
42411459 gtgaatttctagccactaggctacttga 42411432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 8)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 40 - 127
Target Start/End: Original strand, 29035002 - 29035092
Alignment:
40 atgcattgtaatatgcaggggcctgg-ttggaaccccagacaccccacgtattcacctgag--gtgaatttctagccactaggctacttga 127  Q
    ||||||| | ||||||||||||| || || ||||||| |||||||||| ||||||| | |   ||||||||||||||||||||||||||||    
29035002 atgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtgaatttctagccactaggctacttga 29035092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 94
Target Start/End: Original strand, 36413779 - 36413841
Alignment:
33 tagggacatgcattgtaatatgcaggggcctg-gttggaaccccagacaccccacgtattcac 94  Q
    |||||||||||||||| ||||||||||||| | ||| ||||||  |||||||||| |||||||    
36413779 tagggacatgcattgttatatgcaggggccggagttcgaaccctggacaccccacttattcac 36413841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 3037691 - 3037634
Alignment:
40 atgcattgtaatatgcaggggcc-tggttggaaccccagacaccccacgtattcacct 96  Q
    ||||||||| |||||||||||||  |||| ||||||| |||||||||| |||||||||    
3037691 atgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcacct 3037634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 30474264 - 30474207
Alignment:
40 atgcattgtaatatgcaggggcct-ggttggaaccccagacaccccacgtattcacct 96  Q
    ||||||| | |||||||||||||  |||| |||||||||||||||||| |||||||||    
30474264 atgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcacct 30474207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 37 - 96
Target Start/End: Original strand, 18089752 - 18089812
Alignment:
37 gacatgcattgtaatatgcaggggcctg-gttggaaccccagacaccccacgtattcacct 96  Q
    |||||||||| || |||||||||||| | ||| |||||||||||||| ||| |||||||||    
18089752 gacatgcattatactatgcaggggccagagttcgaaccccagacacctcacttattcacct 18089812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 29 - 96
Target Start/End: Complemental strand, 44487847 - 44487779
Alignment:
29 ttgatagggacatgcattgtaatatgcaggggcctg-gttggaaccccagacaccccacgtattcacct 96  Q
    |||||||||||||||||| | ||||||| ||||| | ||| ||||||| |||| ||||| |||||||||    
44487847 ttgatagggacatgcattattatatgcaagggccggagttcgaaccccggacatcccacttattcacct 44487779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 50 - 127
Target Start/End: Original strand, 5207129 - 5207210
Alignment:
50 atatgcaggggcctggttggaaccccagacaccccacgtattcacc--tgaggtgaatttc--tagccactaggctacttga 127  Q
    ||||||||||| | | || |||||||||||||||||| ||||||||  | || ||||||||  |||||||||| ||||||||    
5207129 atatgcaggggtcggattcgaaccccagacaccccacttattcacctttaagatgaatttctttagccactagactacttga 5207210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 100 - 127
Target Start/End: Complemental strand, 15625291 - 15625264
Alignment:
100 gtgaatttctagccactaggctacttga 127  Q
    ||||||||||||||||||||||||||||    
15625291 gtgaatttctagccactaggctacttga 15625264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0809 (Bit Score: 35; Significance: 0.00000000006; HSPs: 1)
Name: scaffold0809
Description:

Target: scaffold0809; HSP #1
Raw Score: 35; E-Value: 0.00000000006
Query Start/End: Original strand, 40 - 127
Target Start/End: Complemental strand, 4874 - 4785
Alignment:
40 atgcattgtaatatgcaggggcctggttggaaccccagacaccccacgtattcacctgag--gtgaatttctagccactaggctacttga 127  Q
    ||||||| | ||||||||||||  |||| ||| ||| |||||||||| ||||||| | |   ||||||||||||||||||||||||||||    
4874 atgcattattatatgcaggggcggggttcgaatcccggacaccccacttattcactttaaaagtgaatttctagccactaggctacttga 4785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.00000000006; HSPs: 10)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000006
Query Start/End: Original strand, 64 - 127
Target Start/End: Original strand, 42355724 - 42355791
Alignment:
64 ggttggaaccccagacaccccacgtattcacct----gaggtgaatttctagccactaggctacttga 127  Q
    |||| ||||||| |||||||||| |||||||||    |||||||||||||||||| ||||||||||||    
42355724 ggtttgaaccccggacaccccacttattcacctttaagaggtgaatttctagccattaggctacttga 42355791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 27025498 - 27025441
Alignment:
40 atgcattgtaatatgcaggggcctgg-ttggaaccccagacaccccacgtattcacct 96  Q
    ||||||||| |||| ||||||||||| || |||||||||||||||||| |||||||||    
27025498 atgcattgttatattcaggggcctgggttcgaaccccagacaccccacttattcacct 27025441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 96
Target Start/End: Complemental strand, 18102029 - 18101961
Alignment:
29 ttgatagggacatgcattgtaatatgcaggggcctg-gttggaaccccagacaccccacgtattcacct 96  Q
    ||||||| |||||| ||| | ||||||||||||| | ||| |||||||||||||||||| |||||||||    
18102029 ttgatagagacatgtattattatatgcaggggccggagttcgaaccccagacaccccacttattcacct 18101961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 64 - 124
Target Start/End: Original strand, 18175258 - 18175322
Alignment:
64 ggttggaaccccagacaccccacgtattcacct----gaggtgaatttctagccactaggctact 124  Q
    |||| |||||||||||| ||||| |||||| ||    ||||||||||||||||||||||||||||    
18175258 ggttcgaaccccagacatcccacttattcatctttatgaggtgaatttctagccactaggctact 18175322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 34 - 92
Target Start/End: Original strand, 25660932 - 25660991
Alignment:
34 agggacatgcattgtaatatgcaggggcctgg-ttggaaccccagacaccccacgtattc 92  Q
    ||||| ||||||||| ||||||||||||| || || |||||||||||||||||| |||||    
25660932 agggatatgcattgttatatgcaggggccgggattcgaaccccagacaccccacttattc 25660991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 34 - 96
Target Start/End: Original strand, 31556838 - 31556901
Alignment:
34 agggacatgcattgtaatatgcaggggcctg-gttggaaccccagacaccccacgtattcacct 96  Q
    ||||||||||||||| ||||||||||| | | ||| ||||||| |||||||||| |||||||||    
31556838 agggacatgcattgttatatgcaggggtcggagttcgaaccccggacaccccacttattcacct 31556901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 127
Target Start/End: Complemental strand, 35813322 - 35813220
Alignment:
29 ttgatagggacatgcattgtaatatgcaggggc-ctggttggaaccccagacaccccacgtattcacctg----aggtgaatttctagccactaggctac 123  Q
    |||| ||||||||||||||| |||||||||||| | |||| ||||||  |||||||||| |||||   ||    ||||||| ||||||||||||||||||    
35813322 ttgacagggacatgcattgttatatgcaggggctcaggttcgaacccaggacaccccacttattcctttgaaaaaggtgaa-ttctagccactaggctac 35813224  T
124 ttga 127  Q
    ||||    
35813223 ttga 35813220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 27 - 127
Target Start/End: Original strand, 28537148 - 28537253
Alignment:
27 aattgatagggacatgcattgtaatatgcaggggcc-tggttggaaccccagacaccccacgtattcac-ctga----ggtgaatttctagccactaggc 120  Q
    |||||| | ||||||||||||| ||||||| |||||  |||| ||||||| |||||||||| |||||||  |||    |||||| |||||||||||||||    
28537148 aattgacatggacatgcattgttatatgcatgggccggggttcgaaccccggacaccccacttattcactttgaaaatggtgaa-ttctagccactaggc 28537246  T
121 tacttga 127  Q
    |||||||    
28537247 tacttga 28537253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 40 - 96
Target Start/End: Original strand, 33800919 - 33800976
Alignment:
40 atgcattgtaatatgcaggggcctgg-ttggaaccccagacaccccacgtattcacct 96  Q
    ||||||| | ||||||||||||| || || |||||||||||||||||| |||||||||    
33800919 atgcattattatatgcaggggccggggttcgaaccccagacaccccacttattcacct 33800976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 34 - 96
Target Start/End: Complemental strand, 3536011 - 3535948
Alignment:
34 agggacatgcattgtaatatgcaggggcc-tggttggaaccccagacaccccacgtattcacct 96  Q
    ||||||||||||||| |||| |||| |||  |||| ||||||| |||||||||| |||||||||    
3536011 agggacatgcattgttatatacaggagccggggttcgaaccccggacaccccacttattcacct 3535948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000002; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 40 - 123
Target Start/End: Complemental strand, 25020597 - 25020511
Alignment:
40 atgcattgtaatatgcaggggcctgg-ttggaaccccagacaccccacgtattcacctga---ggtgaatttctagccactaggctac 123  Q
    ||||||| | |||||||||||||||| || ||||||| |||||||||| ||||||||| |   |||||||| ||||||||||||||||    
25020597 atgcattattatatgcaggggcctgggttcgaaccccggacaccccacttattcaccttataaggtgaatt-ctagccactaggctac 25020511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 40 - 123
Target Start/End: Complemental strand, 5134503 - 5134417
Alignment:
40 atgcattgtaatatgcaggggcct-ggttggaaccccagacaccccacgtattcacc---tgaggtgaatttctagccactaggctac 123  Q
    ||||||||| |||||||| ||||  |||| ||||| |||||||||||| ||||||||   | ||||||| ||||||||||||||||||    
5134503 atgcattgttatatgcagaggccgcggttcgaacctcagacaccccacttattcaccttataaggtgaa-ttctagccactaggctac 5134417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 29 - 92
Target Start/End: Original strand, 5544291 - 5544355
Alignment:
29 ttgatagggacatgcattgtaatatgcagggg-cctggttggaaccccagacaccccacgtattc 92  Q
    |||||||||||||| ||||| ||||||||||| |  |||| |||||||||| ||||||| |||||    
5544291 ttgatagggacatgtattgttatatgcaggggtcggggttcgaaccccagataccccacttattc 5544355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 34 - 97
Target Start/End: Original strand, 34524895 - 34524959
Alignment:
34 agggacatgcattgtaatatgcaggggcc-tggttggaaccccagacaccccacgtattcacctg 97  Q
    ||||||||||||||| |||||||||||||  |||| || ||||  ||||||||| ||||||||||    
34524895 agggacatgcattgttatatgcaggggccggggttcgagccccgaacaccccacttattcacctg 34524959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 34 - 96
Target Start/End: Original strand, 8309184 - 8309247
Alignment:
34 agggacatgcattgtaatatgcaggggcc-tggttggaaccccagacaccccacgtattcacct 96  Q
    ||||||||||||||| ||||||| |||||  | || ||||||| |||||||||| |||||||||    
8309184 agggacatgcattgttatatgcatgggccaagtttcgaaccccggacaccccacctattcacct 8309247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 34 - 92
Target Start/End: Original strand, 30833037 - 30833096
Alignment:
34 agggacatgcattgtaatatgcagggg-cctggttggaaccccagacaccccacgtattc 92  Q
    ||||||||||||||| ||||||||||| |  |||| ||||||| |||||||||| |||||    
30833037 agggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattc 30833096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0032 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0032
Description:

Target: scaffold0032; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 127
Target Start/End: Original strand, 41987 - 42017
Alignment:
97 gaggtgaatttctagccactaggctacttga 127  Q
    |||||||||||||||||||||||||||||||    
41987 gaggtgaatttctagccactaggctacttga 42017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University