View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9365-LTR4-TNT-insertion-9 (Length: 116)
Name: F9365-LTR4-TNT-insertion-9
Description: F9365-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9365-LTR4-TNT-insertion-9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 3e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 3e-33
Query Start/End: Original strand, 27 - 106
Target Start/End: Original strand, 47446522 - 47446601
Alignment:
| Q |
27 |
aattgttataaccgatttgattacattctgttatagcttaacagtatcttagctactctattctctgatggattagaatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
47446522 |
aattgttataaccgatttgattacattctgttatagcttaacagtagcttagctactctattctctgatagattagaatt |
47446601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University