View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9367-LTR4-TNT-insertion-2 (Length: 103)
Name: F9367-LTR4-TNT-insertion-2
Description: F9367-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9367-LTR4-TNT-insertion-2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 5e-41; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 5e-41
Query Start/End: Original strand, 9 - 93
Target Start/End: Complemental strand, 4918456 - 4918372
Alignment:
| Q |
9 |
gaactactctttttagcaaaagctggtaatatctctctattatacgcatcaaatctcttgtctataatgtccaaatacatcatta |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4918456 |
gaactactctttttagcaaaagctggtaatatctctctattatacgcatcaaatctcttgtctataatgtccaaatacatcatta |
4918372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 271 times since January 2019
Visitors: 962