View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9367-LTR4-TNT-insertion-7 (Length: 345)
Name: F9367-LTR4-TNT-insertion-7
Description: F9367-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9367-LTR4-TNT-insertion-7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 10 - 308
Target Start/End: Complemental strand, 26915740 - 26915443
Alignment:
| Q |
10 |
ctgtttggttcctttccaaaccagcgtaatcaactttaattggttcaggtgcttgctttttagatttcannnnnnnnnnnctttctgttccacaaaatat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
26915740 |
ctgtttggttcctttccaaaccagcgtaatcaactttaattggttcaggtgcttgctttttagatttcatttttttttt-ctttctgttccacagaatat |
26915642 |
T |
 |
| Q |
110 |
gttttcaacacaggatcaagcggtagggaatgaaaaggtcgataaatctgtggcaaaaattccgggagtgtatttcattatcgagaatgcctcgtttgtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26915641 |
gttttcaacacaggatcaagcggtagggaatgaagaggtcgataaatctgtggcagaaattccgggagtgtatttcattatcgagaatgcctcgtttgtt |
26915542 |
T |
 |
| Q |
210 |
gtggcttgtctttacaaagtcagtacttttcttttccctctcagtttcatctgatgaaatttttattgaaaagagtgaaatttgtatattttacatgcc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26915541 |
gtggcttgtctttacaaagtcagtacttttcttttccctctcagtttcatctgatgaaatttttattgaagagagtgaaatttgtatattttacatgcc |
26915443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 91 - 205
Target Start/End: Complemental strand, 51183304 - 51183190
Alignment:
| Q |
91 |
tttctgttccacaaaatatgttttcaacacaggatcaagcggtagggaatgaaaaggtcgataaatctgtggcaaaaattccgggagtgtatttcattat |
190 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||| ||||| ||||||||| || |||| ||||||||||||||||| |
|
|
| T |
51183304 |
tttctgttccacagaatatgctttcaacacaggatcaagcggtagggaatgaagaggttgataagtctgtggcagaatttccaggagtgtatttcattat |
51183205 |
T |
 |
| Q |
191 |
cgagaatgcctcgtt |
205 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
51183204 |
tgagaaagcctcgtt |
51183190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University