View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9422H-LTR4-TNT-insertion-12 (Length: 130)

Name: F9422H-LTR4-TNT-insertion-12
Description: F9422H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9422H-LTR4-TNT-insertion-12
F9422H-LTR4-TNT-insertion-12
[»] chr7 (1 HSPs)
chr7 (8-120)||(48101097-48101209)


Alignment Details
Target: chr7 (Bit Score: 92; Significance: 4e-45; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 92; E-Value: 4e-45
Query Start/End: Original strand, 8 - 120
Target Start/End: Original strand, 48101097 - 48101209
Alignment:
8 cagaatcccgaatacaaatgccaattccagttcgggaatttgtcaatcccaaacacttnnnnnnncgtagagggtatttgtcaatttttcaacactactt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||    
48101097 cagaatcccgaatacaaatgccaattccagttcgggaatttgtcaatcccaaacacttaaaaaaacgtagagggtatttgtcaatttttcaacactactt 48101196  T
108 ccttttttgaatt 120  Q
    |||||||||||||    
48101197 ccttttttgaatt 48101209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University