View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9422H-LTR4-TNT-insertion-13 (Length: 127)
Name: F9422H-LTR4-TNT-insertion-13
Description: F9422H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9422H-LTR4-TNT-insertion-13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 1e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 10 - 118
Target Start/End: Original strand, 801774 - 801882
Alignment:
| Q |
10 |
taataagcagcaagagctccaaagaagcatgcaagagttgcactaattgcaaccataaccttcnnnnnnnctctcacattaaaactcttgttctttgaaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
801774 |
taataagcagcaagagctccaaagaagcatgcaagagttgcactaattgcaaccataaccttcaaaaaaactctcacattaaaactcttgttctttgaaa |
801873 |
T |
|
| Q |
110 |
cttcaattg |
118 |
Q |
| |
|
||||||||| |
|
|
| T |
801874 |
cttcaattg |
801882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 50 times since January 2019
Visitors: 8143