View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9422H-LTR4-TNT-insertion-14 (Length: 161)
Name: F9422H-LTR4-TNT-insertion-14
Description: F9422H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9422H-LTR4-TNT-insertion-14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 145; Significance: 1e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 7 - 151
Target Start/End: Original strand, 32958299 - 32958443
Alignment:
Q |
7 |
accaaatttgtcaatggggcttagattatcttcgtcgtaagaagaacatcatcaacggtaagaattgacaagagattgttgcagaacatgttaatgaagt |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32958299 |
accaaatttgtcaatggggcttagattatcttcgtcgtaagaagaacatcatcaacggtaagaattgacaagagattgttgcagaacatgttaatgaagt |
32958398 |
T |
 |
Q |
107 |
atatgttttcgaataaaattaagaaccatgatttgcaaacgaatt |
151 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32958399 |
atatgttttcgaataaaattaagaaccatgatttgcaaacgaatt |
32958443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University