View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9422H-LTR4-TNT-insertion-6 (Length: 191)
Name: F9422H-LTR4-TNT-insertion-6
Description: F9422H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9422H-LTR4-TNT-insertion-6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 3e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 10 - 130
Target Start/End: Original strand, 9000866 - 9000986
Alignment:
| Q |
10 |
ataggtacatttatttatattgcctacttatatctcttcttggtccttgacaaaaaatgaatagcaatggaccatgtaatcatgcaatctccctagtttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9000866 |
ataggtacatttatttatattgcctacttatatctcttcttggtccttgacaaaaaatgaatagcaatggaccatgtaatcatgcaatctccctagtttt |
9000965 |
T |
|
| Q |
110 |
acaaagaatatgagtagccat |
130 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9000966 |
acaaagaatatgagtagccat |
9000986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 55 - 108
Target Start/End: Original strand, 8532651 - 8532704
Alignment:
| Q |
55 |
cttgacaaaaaatgaatagcaatggaccatgtaatcatgcaatctccctagttt |
108 |
Q |
| |
|
||||||||||||||||| || |||| ||| |||||||||| |||||||||||| |
|
|
| T |
8532651 |
cttgacaaaaaatgaattacagtggatcatataatcatgcagtctccctagttt |
8532704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 60 times since January 2019
Visitors: 8149