View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9458H-LTR4-TNT-insertion-3 (Length: 255)
Name: F9458H-LTR4-TNT-insertion-3
Description: F9458H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9458H-LTR4-TNT-insertion-3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 9 - 247
Target Start/End: Complemental strand, 13220241 - 13220003
Alignment:
| Q |
9 |
ctatagttaagaacaaaaatgcaatcatgtgttagtttgtcaagggttctgaattaacttgggaagtacgatagattctaaatgagatgttttgctttta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13220241 |
ctatagttaagaacaaaaatgcaatcatgtgttagtttgtcaagggttctgaattaacttgggaagtacgatagattctaaatgagatgttttgctttta |
13220142 |
T |
|
| Q |
109 |
caaaactttgaatctcttgctctgatagaataaagactaaaagcttttaataaataaataatttatgaaatagaaagagtataaactatgttgtcgaact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13220141 |
caaaactttgaatctcttgctctgatagaataaagactaaaagcttttaataaataaataatttatgaaatagaaagagtataaactatgttgtcgaact |
13220042 |
T |
|
| Q |
209 |
tgaaagttagtcgagtatttgactaatagctctcaattg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13220041 |
tgaaagttagtcgagtatttgactaatagctctcaattg |
13220003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 411 times since January 2019
Visitors: 972