View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9458H-LTR4-TNT-insertion-4 (Length: 123)
Name: F9458H-LTR4-TNT-insertion-4
Description: F9458H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9458H-LTR4-TNT-insertion-4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 3e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 10 - 113
Target Start/End: Original strand, 42376866 - 42376969
Alignment:
Q |
10 |
gaaatcatatgttcacatattagttctcctgcaacaccgaagagtaaataacaaatcaagagctctgaaaattgacagaaattttgaaaacaaaaaagaa |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42376866 |
gaaatcatatgttcacatattagttctcctgcaacaccgaagagtaaataacaaatcaagagctctgaaaattgacagaaattttgaaaacaaaaaagaa |
42376965 |
T |
 |
Q |
110 |
atta |
113 |
Q |
|
|
|||| |
|
|
T |
42376966 |
atta |
42376969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 33 - 64
Target Start/End: Original strand, 17309520 - 17309551
Alignment:
Q |
33 |
ttctcctgcaacaccgaagagtaaataacaaa |
64 |
Q |
|
|
|||||||||||||| ||||||||||||||||| |
|
|
T |
17309520 |
ttctcctgcaacacggaagagtaaataacaaa |
17309551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University