View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9473H-LTR4-TNT-insertion-1 (Length: 52)
Name: F9473H-LTR4-TNT-insertion-1
Description: F9473H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9473H-LTR4-TNT-insertion-1 |
 | |
|
| [»] scaffold0707 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0707 (Bit Score: 37; Significance: 0.0000000000009; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 37; E-Value: 0.0000000000009
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 1600 - 1564
Alignment:
| Q |
8 |
cgaccgattgaaaggggcttatataaatttcaattgg |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1600 |
cgaccgattgaaaggggcttatataaatttcaattgg |
1564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.0000000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.0000000000009
Query Start/End: Original strand, 8 - 44
Target Start/End: Original strand, 33572192 - 33572228
Alignment:
| Q |
8 |
cgaccgattgaaaggggcttatataaatttcaattgg |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33572192 |
cgaccgattgaaaggggcttatataaatttcaattgg |
33572228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10423 times since January 2019
Visitors: 10020