View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9473H-LTR4-TNT-insertion-1 (Length: 52)

Name: F9473H-LTR4-TNT-insertion-1
Description: F9473H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9473H-LTR4-TNT-insertion-1
F9473H-LTR4-TNT-insertion-1
[»] scaffold0707 (1 HSPs)
scaffold0707 (8-44)||(1564-1600)
[»] chr6 (1 HSPs)
chr6 (8-44)||(33572192-33572228)


Alignment Details
Target: scaffold0707 (Bit Score: 37; Significance: 0.0000000000009; HSPs: 1)
Name: scaffold0707
Description:

Target: scaffold0707; HSP #1
Raw Score: 37; E-Value: 0.0000000000009
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 1600 - 1564
Alignment:
8 cgaccgattgaaaggggcttatataaatttcaattgg 44  Q
    |||||||||||||||||||||||||||||||||||||    
1600 cgaccgattgaaaggggcttatataaatttcaattgg 1564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.0000000000009; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.0000000000009
Query Start/End: Original strand, 8 - 44
Target Start/End: Original strand, 33572192 - 33572228
Alignment:
8 cgaccgattgaaaggggcttatataaatttcaattgg 44  Q
    |||||||||||||||||||||||||||||||||||||    
33572192 cgaccgattgaaaggggcttatataaatttcaattgg 33572228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University