View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9473H-LTR4-TNT-insertion-7 (Length: 172)
Name: F9473H-LTR4-TNT-insertion-7
Description: F9473H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9473H-LTR4-TNT-insertion-7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 2e-81; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 2e-81
Query Start/End: Original strand, 10 - 162
Target Start/End: Complemental strand, 39806438 - 39806286
Alignment:
| Q |
10 |
gagaatgtcaattgatggttaattttatggctattcattgtgatggagaatatcataaacattatgttaatgatcatgatcatgaatcatagacaacatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39806438 |
gagaatgtcaattgatggttaattttatggctattcattgtgatggagaatatcataaacattatgttaatgatcatgatcatgaatcatagacaacatg |
39806339 |
T |
|
| Q |
110 |
gatttcttcctcactgtagctgataaaattgagccttgtgtttcgtttcatta |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39806338 |
gatttcttcctcactgtagctgataaaattgagccttgtgtttcgtttcatta |
39806286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 3e-43
Query Start/End: Original strand, 10 - 153
Target Start/End: Complemental strand, 39922962 - 39922821
Alignment:
| Q |
10 |
gagaatgtcaattgatggttaattttatggctattcattgtgatggagaatatcataaacattatgttaatgatcatgatcatgaatcatagacaacatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| ||| |||||||| |||| ||||||||||| | ||||| ||||||||||||| |
|
|
| T |
39922962 |
gagaatgtcaattgatggttaattttatggcttttcattgtgatggaaaat--cataaacaatatgctaatgatcatgctaatgaaccatagacaacatg |
39922865 |
T |
|
| Q |
110 |
gatttcttcctcactgtagctgataaaattgagccttgtgtttc |
153 |
Q |
| |
|
|| ||||||||||||||||||||||||| |||| || ||||||| |
|
|
| T |
39922864 |
gacttcttcctcactgtagctgataaaagtgagtctcgtgtttc |
39922821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 14 - 109
Target Start/End: Complemental strand, 39815707 - 39815612
Alignment:
| Q |
14 |
atgtcaattgatggttaattttatggctattcattgtgatggagaatatcataaacattatgttaatgatcatgatcatgaatcatagacaacatg |
109 |
Q |
| |
|
|||||| |||||||||||||||||||| || ||||||||| |||||||||||||| |||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
39815707 |
atgtcagttgatggttaattttatggcattttcttgtgatggtgaatatcataaacaatatgctaataatcgtgatcatgaatcatagacaacatg |
39815612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 55; E-Value: 7e-23
Query Start/End: Original strand, 13 - 161
Target Start/End: Complemental strand, 39903327 - 39903186
Alignment:
| Q |
13 |
aatgtcaattgatggttaattttatggctattcattgtgatggagaatatcataaacattatgttaatgatcatgatcatgaatcatagacaacatggat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |||| |||| | || | |||||||||||||| |
|
|
| T |
39903327 |
aatgtcaattgatggttaattttatggctttttattgtgatggagaatatcataaacaatatgctaatttacttg-------ctaatagacaacatggac |
39903235 |
T |
|
| Q |
113 |
ttcttcctcactgtagctgataaaattgagccttgtgtttcgtttcatt |
161 |
Q |
| |
|
||||||||||||||| || ||||| ||||||| ||||||| ||||||| |
|
|
| T |
39903234 |
ttcttcctcactgtaactagtaaaaatgagcctcgtgtttcatttcatt |
39903186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10326 times since January 2019
Visitors: 10003