View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9473H-LTR4-TNT-insertion-8 (Length: 150)
Name: F9473H-LTR4-TNT-insertion-8
Description: F9473H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9473H-LTR4-TNT-insertion-8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 2e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 2e-47
Query Start/End: Original strand, 36 - 135
Target Start/End: Complemental strand, 43096669 - 43096570
Alignment:
| Q |
36 |
gacaactataagatgataccacctttttattgattcttcctcatccatatataatattctattctatggaagttaattatgcaccaattaatgttgatat |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43096669 |
gacaactataagatgataccacctttttattgattcttcttcatccatatataatattctattctatggaagttaattatgcaccaattaatgttgatat |
43096570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10376 times since January 2019
Visitors: 10012