View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9482H-LTR4-TNT-insertion-14 (Length: 169)
Name: F9482H-LTR4-TNT-insertion-14
Description: F9482H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9482H-LTR4-TNT-insertion-14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 9e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 9e-50
Query Start/End: Original strand, 9 - 108
Target Start/End: Complemental strand, 37082841 - 37082742
Alignment:
| Q |
9 |
tgttgaccaaaggttttggaaccggaatctcagaatggatgacatttatacgcaattaaattatcatttaatgccaaatcaccttccttgcttgtgactt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37082841 |
tgttgaccaaaggttttggaaccggaatctcagaatggatgacatttatacgcaattaaattatcatttaatgccaaatcaccttccttgcttgtgactt |
37082742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University