View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9482H-LTR4-TNT-insertion-15 (Length: 126)
Name: F9482H-LTR4-TNT-insertion-15
Description: F9482H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9482H-LTR4-TNT-insertion-15 |
 | |
|
| [»] scaffold0312 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0312 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: scaffold0312
Description:
Target: scaffold0312; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 8 - 117
Target Start/End: Original strand, 12974 - 13083
Alignment:
| Q |
8 |
gtacgcagtgcagtacaatacaactagttatgttaccttatctaggtttggactagagctgctctcttcatcaggcaaaagaatccaagccacaatgcac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12974 |
gtacgcagtgcagtacaatacaactagttatgttaccttatctaggtttggactagagctgctctcttcatcaggcaaaagaatccaagccacaatgcac |
13073 |
T |
|
| Q |
108 |
atgtcaattg |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
13074 |
atgtcaattg |
13083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 110; Significance: 7e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 8 - 117
Target Start/End: Complemental strand, 417597 - 417488
Alignment:
| Q |
8 |
gtacgcagtgcagtacaatacaactagttatgttaccttatctaggtttggactagagctgctctcttcatcaggcaaaagaatccaagccacaatgcac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
417597 |
gtacgcagtgcagtacaatacaactagttatgttaccttatctaggtttggactagagctgctctcttcatcaggcaaaagaatccaagccacaatgcac |
417498 |
T |
|
| Q |
108 |
atgtcaattg |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
417497 |
atgtcaattg |
417488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 9e-40
Query Start/End: Original strand, 15 - 117
Target Start/End: Original strand, 981628 - 981730
Alignment:
| Q |
15 |
gtgcagtacaatacaactagttatgttaccttatctaggtttggactagagctgctctcttcatcaggcaaaagaatccaagccacaatgcacatgtcaa |
114 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||| |||| |
|
|
| T |
981628 |
gtgcagtacaatacaactatttatgttaccttatctaggtttggactagagctactctcttcatcaggccacagaatccaagccacaatgcacatatcaa |
981727 |
T |
|
| Q |
115 |
ttg |
117 |
Q |
| |
|
||| |
|
|
| T |
981728 |
ttg |
981730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 958 times since January 2019
Visitors: 1117