View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9482H-LTR4-TNT-insertion-4 (Length: 163)
Name: F9482H-LTR4-TNT-insertion-4
Description: F9482H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9482H-LTR4-TNT-insertion-4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 3e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 3e-77
Query Start/End: Original strand, 8 - 153
Target Start/End: Original strand, 33170586 - 33170731
Alignment:
| Q |
8 |
actctggcttatggaaacaaagtggcgtcgataaataaaacaatgataaatagaaaatcaaaagtatagcatcaaagataagtgtactatatgataaatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33170586 |
actctggcttatggaaacaaagtggcgtcgataaataaaacaatgataaatagaaaatcaaaagtatagcatcaaagataagtgtactatatgataaatg |
33170685 |
T |
 |
| Q |
108 |
tgtcttgaattcgtttgaatctcttagtcacttcaaaatttgaatt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33170686 |
tgtcttgaattcgtttgaatctcttagtcacttcaaaatttgaatt |
33170731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University