View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9482H-LTR4-TNT-insertion-5 (Length: 122)
Name: F9482H-LTR4-TNT-insertion-5
Description: F9482H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9482H-LTR4-TNT-insertion-5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 2e-53; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 8 - 113
Target Start/End: Original strand, 36663604 - 36663709
Alignment:
| Q |
8 |
taacaatactataagttttttcagggaactttgatggcttttgttaatttatctcaagggaagcttttgaatatgttgagatcagctgcattactcagtc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36663604 |
taacaatactataagttttttcagggaactttgatggcttttgttaatttatctcaagggaagcttttgaatatgttgagatcagctgcattactcagtc |
36663703 |
T |
 |
| Q |
108 |
caattg |
113 |
Q |
| |
|
|||||| |
|
|
| T |
36663704 |
caattg |
36663709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 5e-26
Query Start/End: Original strand, 26 - 113
Target Start/End: Complemental strand, 36705429 - 36705342
Alignment:
| Q |
26 |
tttcagggaactttgatggcttttgttaatttatctcaagggaagcttttgaatatgttgagatcagctgcattactcagtccaattg |
113 |
Q |
| |
|
|||||||||||||| || ||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36705429 |
tttcagggaactttaatagcttttgttgctttatctcaagggaaacttctgaatatgttgagatcagctgcattacttagtccaattg |
36705342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 4e-17
Query Start/End: Original strand, 24 - 112
Target Start/End: Complemental strand, 36689111 - 36689023
Alignment:
| Q |
24 |
tttttcagggaactttgatggcttttgttaatttatctcaagggaagcttttgaatatgttgagatcagctgcattactcagtccaatt |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||| ||| || ||||||||||||| |||| ||||||||| ||||| | ||||||||| |
|
|
| T |
36689111 |
tttttcatggaactttgatggcttttgttgctttacctcgagagaagcttttgaatgtgtttagatcagctacattatttagtccaatt |
36689023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 28 - 113
Target Start/End: Complemental strand, 36712974 - 36712889
Alignment:
| Q |
28 |
tcagggaactttgatggcttttgttaatttatctcaagggaagcttttgaatatgttgagatcagctgcattactcagtccaattg |
113 |
Q |
| |
|
||||||||||||||| ||||||| | ||| |||||||| |||||| | ||| | || ||||| ||||||||||| |||||||||| |
|
|
| T |
36712974 |
tcagggaactttgatagcttttgctgctttttctcaaggaaagcttcttaatgtatttagatcggctgcattacttagtccaattg |
36712889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 24 - 113
Target Start/End: Original strand, 30904528 - 30904617
Alignment:
| Q |
24 |
tttttcagggaactttgatggcttttgttaatttatctcaagggaagcttttgaatatgttgagatcagctgcattactcagtccaattg |
113 |
Q |
| |
|
||||| |||||||||| ||||| |||| | |||||||||||| || ||| ||||||||||| ||||| |||||||||| |||||||||| |
|
|
| T |
30904528 |
ttttttagggaactttaatggcatttgctgctttatctcaaggaaatcttgtgaatatgttgcgatcaactgcattacttagtccaattg |
30904617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University