View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9488H-LTR4-TNT-insertion-2 (Length: 90)
Name: F9488H-LTR4-TNT-insertion-2
Description: F9488H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9488H-LTR4-TNT-insertion-2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 43; Significance: 5e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 5e-16
Query Start/End: Original strand, 35 - 77
Target Start/End: Complemental strand, 18345905 - 18345863
Alignment:
| Q |
35 |
gggggtatgcgaaaaatgataatagatcgaatcgttaacatta |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18345905 |
gggggtatgcgaaaaatgataatagatcgaatcgttaacatta |
18345863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 5e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 5e-16
Query Start/End: Original strand, 35 - 77
Target Start/End: Original strand, 13238587 - 13238629
Alignment:
| Q |
35 |
gggggtatgcgaaaaatgataatagatcgaatcgttaacatta |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13238587 |
gggggtatgcgaaaaatgataatagatcgaatcgttaacatta |
13238629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 36 - 77
Target Start/End: Complemental strand, 14264142 - 14264101
Alignment:
| Q |
36 |
ggggtatgcgaaaaatgataatagatcgaatcgttaacatta |
77 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
14264142 |
ggggtatgcgaaaaatgataatagatggcgtcgttaacatta |
14264101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 910 times since January 2019
Visitors: 1114