View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9508H-LTR4-TNT-insertion-3 (Length: 201)
Name: F9508H-LTR4-TNT-insertion-3
Description: F9508H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9508H-LTR4-TNT-insertion-3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 10 - 191
Target Start/End: Original strand, 47053691 - 47053872
Alignment:
| Q |
10 |
agctgccaagaaagttcacattgatggaactacagcctatgcagtttctggtttgttttctgttttttctccttcttcctgataatcaatgtgttttctg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47053691 |
agctgccaagaaagttcacattgatggaactacagcctatgcagtttctggtttgttttctgttttttctccttcttcctgataatcaatgtgttttctg |
47053790 |
T |
 |
| Q |
110 |
atgatgctgttgatacattatttgatatatctttgtaatactgtttttcatcggatgaatttctggcagatccctttcatta |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47053791 |
atgatgctgttgatacattatttgatatatctttgtaatactgtttttcatcggatgaatttctggcagatccctttcatta |
47053872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 13 - 76
Target Start/End: Original strand, 47061886 - 47061949
Alignment:
| Q |
13 |
tgccaagaaagttcacattgatggaactacagcctatgcagtttctggtttgttttctgttttt |
76 |
Q |
| |
|
||||||||||||||| ||| ||||||| |||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
47061886 |
tgccaagaaagttcatattaatggaaccacagcctatgcagtttctagtttgatttctgttttt |
47061949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 12 - 58
Target Start/End: Original strand, 47063574 - 47063620
Alignment:
| Q |
12 |
ctgccaagaaagttcacattgatggaactacagcctatgcagtttct |
58 |
Q |
| |
|
|||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
47063574 |
ctgccaagaaagctcaccttgatggaaccacagcctatgcagtttct |
47063620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University