View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9516H-LTR4-TNT-insertion-7 (Length: 174)
Name: F9516H-LTR4-TNT-insertion-7
Description: F9516H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9516H-LTR4-TNT-insertion-7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 4e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 4e-21
Query Start/End: Original strand, 110 - 165
Target Start/End: Original strand, 47915208 - 47915263
Alignment:
Q |
110 |
agtgagaaaagaaaatccattatttcctccgttgtcaattactcttcattcaatta |
165 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
47915208 |
agtgagaaaagaaaatctattatttcctccgttgtcaattactcttcattcaatta |
47915263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000006
Query Start/End: Original strand, 10 - 44
Target Start/End: Original strand, 47915108 - 47915142
Alignment:
Q |
10 |
aaacatatttaattattttgcttatatttgaaata |
44 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
47915108 |
aaacatatttaattattttgcttatatttgaaata |
47915142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University