View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9531H-LTR4-TNT-insertion-13 (Length: 299)
Name: F9531H-LTR4-TNT-insertion-13
Description: F9531H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9531H-LTR4-TNT-insertion-13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 8 - 289
Target Start/End: Complemental strand, 51397556 - 51397275
Alignment:
| Q |
8 |
actacttgtagaagctctaacacatatttctcgccggatgcatttggcaatgttggagaatttcaattactgtgtcaataggttttagttgaactgcaga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51397556 |
actacttgtagaagctctaacacatatttctcgccggatgcatttggcaatgttggagaatttcaattactgtgtcaataggttttagttgaactgcaga |
51397457 |
T |
|
| Q |
108 |
ggcttggaagcatataagcttgtcaattttgcttcgtttcagctgtttttagcatgggactggatctggtattacaatgctgctctgcatttttattctg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51397456 |
ggcttggaagcatataagcttgtcaattttgcttcgtttcagctgtttttagcatgggactggatctggtattacaatgctgctctgcatttttattctg |
51397357 |
T |
|
| Q |
208 |
taattctgttttggatatattttctcagctctttagtgttgtgtttagttttccaaagtttctctcttgaaatctatgaatt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51397356 |
taattctgttttggatatattttctcagctctttagtgttgtgtttagttttccaaagtttctctcttgaaatctatgaatt |
51397275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 948 times since January 2019
Visitors: 1117