View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9531H-LTR4-TNT-insertion-14 (Length: 165)
Name: F9531H-LTR4-TNT-insertion-14
Description: F9531H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9531H-LTR4-TNT-insertion-14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 8 - 157
Target Start/End: Original strand, 9587984 - 9588133
Alignment:
| Q |
8 |
gcagtggcacaaatgtatcatcatatagtcaagttagctatcccnnnnnnnngtcttaatcgccgtcttcttcctaagggaagctagggctctggtaatc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9587984 |
gcagtggcacaaatgtatcatcatatagtcaagttagctatcccttttttttgtcttaatcgccgtcttcttcctaagggaagctagggctctggtaatc |
9588083 |
T |
 |
| Q |
108 |
cagagttcgttgggaagcaagtaaagtcttgtcaaatattgtttcaatta |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9588084 |
cagagttcgttgggaagcaagtaaagtcttgtcaaatattgtttcaatta |
9588133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University