View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9531H-LTR4-TNT-insertion-16 (Length: 119)

Name: F9531H-LTR4-TNT-insertion-16
Description: F9531H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9531H-LTR4-TNT-insertion-16
F9531H-LTR4-TNT-insertion-16
[»] chr3 (3 HSPs)
chr3 (9-109)||(27334347-27334447)
chr3 (9-109)||(18734522-18734620)
chr3 (9-109)||(27364268-27364366)
[»] scaffold0043 (1 HSPs)
scaffold0043 (9-109)||(87658-87758)


Alignment Details
Target: chr3 (Bit Score: 97; Significance: 4e-48; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 9 - 109
Target Start/End: Original strand, 27334347 - 27334447
Alignment:
9 agatgaacgcaaagaagaaagatcagccactaatgcaaagtataacgaacgagattgaacaatatgactatccagctgtgaagtttgtgatgatgagatt 108  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27334347 agatgaacgcaaagaagaaagatcagccactaatgcaaggtataacgaacgagattgaacaatatgactatccagctgtgaagtttgtgatgatgagatt 27334446  T
109 a 109  Q
    |    
27334447 a 27334447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 82; E-Value: 3e-39
Query Start/End: Original strand, 9 - 109
Target Start/End: Complemental strand, 18734620 - 18734522
Alignment:
9 agatgaacgcaaagaagaaagatcagccactaatgcaaagtataacgaacgagattgaacaatatgactatccagctgtgaagtttgtgatgatgagatt 108  Q
    ||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||    
18734620 agatgaacgcaaagaagaaagatcagccactcatgcaaggtataacgaacgagattgaaca--atgactatccagctgtgaagtttgtgatgatgagatt 18734523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 82; E-Value: 3e-39
Query Start/End: Original strand, 9 - 109
Target Start/End: Original strand, 27364268 - 27364366
Alignment:
9 agatgaacgcaaagaagaaagatcagccactaatgcaaagtataacgaacgagattgaacaatatgactatccagctgtgaagtttgtgatgatgagatt 108  Q
    ||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||    
27364268 agatgaacgcaaagaagaaagatcagccactcatgcaaggtataacgaacgagattgaaca--atgactatccagctgtgaagtttgtgatgatgagatt 27364365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0043 (Bit Score: 93; Significance: 9e-46; HSPs: 1)
Name: scaffold0043
Description:

Target: scaffold0043; HSP #1
Raw Score: 93; E-Value: 9e-46
Query Start/End: Original strand, 9 - 109
Target Start/End: Complemental strand, 87758 - 87658
Alignment:
9 agatgaacgcaaagaagaaagatcagccactaatgcaaagtataacgaacgagattgaacaatatgactatccagctgtgaagtttgtgatgatgagatt 108  Q
    ||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
87758 agatgaacgcaaagaagaaagatcagccactcatgcaaggtataacgaacgagattgaacaatatgactatccagctgtgaagtttgtgatgatgagatt 87659  T
109 a 109  Q
    |    
87658 a 87658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University