View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9531H-LTR4-TNT-insertion-17 (Length: 415)
Name: F9531H-LTR4-TNT-insertion-17
Description: F9531H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9531H-LTR4-TNT-insertion-17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 245 - 406
Target Start/End: Original strand, 31977927 - 31978088
Alignment:
| Q |
245 |
atcttccccatgtgcatgcttgctttcatcccaaacaaaggtatagtgaaaaccgaattgtttggctattcaagagattattggagcgtgtagctacgct |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31977927 |
atcttccccatgtgcatgcttgctttcatcccaaacaaaggtatagtgaaaaccgaattgtttggctattcaagagattattggagcgtgtagctacgct |
31978026 |
T |
|
| Q |
345 |
ccttagaagagaagtgaggaattagtccaagaaacagtgtccattttcaacacatgcaattg |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31978027 |
ccttagaagagaagtgaggaattagtccaagaaacagtgtccattttcaacacatgcaattg |
31978088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 9 - 183
Target Start/End: Original strand, 31977691 - 31977865
Alignment:
| Q |
9 |
taggattgtcttttcttatttggaatcctagctttcttttaatgtttgttttctcacattcatannnnnnnatttattcatttcttatgagatatgaaac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31977691 |
taggattgtcttttcttatttggaatcctagctttcttttaatgtttgttttctcacattcatatttttttatttattcatttcttatgagatatgaaac |
31977790 |
T |
|
| Q |
109 |
catcttgatagaaataatatgacttgaattgtcnnnnnnngataataatatcacttgaagattataattattggg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31977791 |
catcttgatagaaataatatgacttgaattgtcaaaaaaagataataatatcacttgaagattataattattggg |
31977865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 933 times since January 2019
Visitors: 1117