View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9531H-LTR4-TNT-insertion-19 (Length: 421)
Name: F9531H-LTR4-TNT-insertion-19
Description: F9531H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9531H-LTR4-TNT-insertion-19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 155 - 394
Target Start/End: Complemental strand, 30923260 - 30923021
Alignment:
| Q |
155 |
acctatgtttatgtcgaagtacaagcaaaggttgtttttatgtctggttttatttgcatggttgtacaatggaagtgtggctatggcggcttcaggtgaa |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30923260 |
acctatgtttatgtcgaagtacaagcaaaggttgtttttatgtctggttttatttgcatggttgtacaatggaagtgtggctatggcggcttcaagtgaa |
30923161 |
T |
 |
| Q |
255 |
gacagtggaagttctaaagaccttgataagacaccaacatgggctgttggttgtgtttgtactgttttcatcttggtttctataattcttgagaaaagtc |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30923160 |
gacagtggaagttctaaagaccttgataagacaccaacatgggctgttggttgtgtttgtactgttttcatcttggtttctataattcttgagaaaagtc |
30923061 |
T |
 |
| Q |
355 |
ttcacaaaattggaacggtatgaaaccaatttgaaacttc |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30923060 |
ttcacaaaattggaacggtatgaaaccaatttgaaacttc |
30923021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 9 - 69
Target Start/End: Complemental strand, 30923406 - 30923346
Alignment:
| Q |
9 |
aaaccaacccatatcagattatggcataaagttgccatctttatctcattctcaacaaacc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30923406 |
aaaccaacccatatcagattatggcataaagttgccatctttatctcattctcaacaaacc |
30923346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University