View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9531H-LTR4-TNT-insertion-2 (Length: 146)
Name: F9531H-LTR4-TNT-insertion-2
Description: F9531H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9531H-LTR4-TNT-insertion-2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 8 - 136
Target Start/End: Complemental strand, 50460996 - 50460868
Alignment:
| Q |
8 |
cctatataaataaaatcacaagtacattattattgttattattccatgcataattatgagattaaaatgaaatcatgagagcaaatgaagcaaaaactta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50460996 |
cctatataaataaaatcacaagtacattattattgttattattccatgcataattatgagattaaaatgaaatcatgagagcaaatgaagcaaaaactta |
50460897 |
T |
|
| Q |
108 |
caaagacttgtccagtgtgattgagaatt |
136 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
50460896 |
caaagacttgtccagtgtgattgagaatt |
50460868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 903 times since January 2019
Visitors: 1113