View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9531H-LTR4-TNT-insertion-3 (Length: 161)
Name: F9531H-LTR4-TNT-insertion-3
Description: F9531H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9531H-LTR4-TNT-insertion-3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 8 - 152
Target Start/End: Complemental strand, 4296036 - 4295892
Alignment:
Q |
8 |
cttatgtccatggaaagttatcttctgatgcatgnnnnnnnnnnnnnattcctattagaaattcctattagaagataactttcaattcaatttgtttata |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4296036 |
cttatgtccatggaaagttatcttctgatgcatgtttttccttttttattcctattagaaattcctattagaagataactttcaattcaatttgtttata |
4295937 |
T |
 |
Q |
108 |
actttcgatcgtattaaatggtattttggggtctgtgagcaattg |
152 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4295936 |
actttcgatcgtattaaatggtattttggggtctgtgagcaattg |
4295892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University