View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9542H-LTR4-TNT-insertion-1 (Length: 103)

Name: F9542H-LTR4-TNT-insertion-1
Description: F9542H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9542H-LTR4-TNT-insertion-1
F9542H-LTR4-TNT-insertion-1
[»] chr5 (1 HSPs)
chr5 (8-94)||(26519523-26519609)
[»] chr2 (1 HSPs)
chr2 (59-94)||(5396824-5396859)


Alignment Details
Target: chr5 (Bit Score: 87; Significance: 3e-42; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 26519609 - 26519523
Alignment:
8 cagttgtttcaggtttagctttaaccgtcgcaatatattcggtcggccatgtctctggtgctcatttcaatccctctgtcacaattg 94  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26519609 cagttgtttcaggtttagctttaaccgtcgcaatatattcggtcggccatgtctctggtgctcatttcaatccctctgtcacaattg 26519523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 59 - 94
Target Start/End: Original strand, 5396824 - 5396859
Alignment:
59 tctctggtgctcatttcaatccctctgtcacaattg 94  Q
    ||||||||||||||||||||||| ||||||| ||||    
5396824 tctctggtgctcatttcaatcccgctgtcaccattg 5396859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University