View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9542H-LTR4-TNT-insertion-1 (Length: 103)
Name: F9542H-LTR4-TNT-insertion-1
Description: F9542H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9542H-LTR4-TNT-insertion-1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 3e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 26519609 - 26519523
Alignment:
| Q |
8 |
cagttgtttcaggtttagctttaaccgtcgcaatatattcggtcggccatgtctctggtgctcatttcaatccctctgtcacaattg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26519609 |
cagttgtttcaggtttagctttaaccgtcgcaatatattcggtcggccatgtctctggtgctcatttcaatccctctgtcacaattg |
26519523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 59 - 94
Target Start/End: Original strand, 5396824 - 5396859
Alignment:
| Q |
59 |
tctctggtgctcatttcaatccctctgtcacaattg |
94 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
5396824 |
tctctggtgctcatttcaatcccgctgtcaccattg |
5396859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 939 times since January 2019
Visitors: 1117