View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9542H-LTR4-TNT-insertion-10 (Length: 185)
Name: F9542H-LTR4-TNT-insertion-10
Description: F9542H-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9542H-LTR4-TNT-insertion-10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 9 - 123
Target Start/End: Complemental strand, 44650281 - 44650167
Alignment:
| Q |
9 |
tttcgagaccgagtagctctatactagaagactcagatatatattcgcatgacaaatgatagaaatcaaacatctttgtaaagtttgagagttcccacct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44650281 |
tttcgagaccgagtagctctatactagaagactcagatatatattcgcatgacaaatgatagaaatcaaacatctttgtaaagtttgagagttcccacct |
44650182 |
T |
 |
| Q |
109 |
ttaatcaaacaatcg |
123 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
44650181 |
ttaatcaaacaatcg |
44650167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University